Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21068  (registered. 2003)
Contig Information
Length 744 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit ribosomal protein L7 [Triticum aestivum]
Score 106
Evalue 0.00443492
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21068
TTTTTTTTTTAACTTAAGAGAGAACGCTGCTGCTTATTATCATTATTATCATCACGAGTTGAGGATTTCATCAGAGTACAACAAACTCATGCAACAAAGA
TTTGCAGCCAACGACAGTTTTAACCAACCATACACGATTAAGGCACAAGGATCCGCAGATGCTGCGAGCAAACAGGGTACAGACGCATGGCAATCGTGGT
GGCGCCGGCGTCCCATCCCGGTGGCGGGGGCGGGATCCGGCGGCGCCTCTCCTGCTACTTCTTGGCGTCCTTGCCCTTGGCGTCCGTGGAGGTGCTCCCG
GAGGCCTGCGCCGCCTTCTTGGCGTTCTTCTCCTCCAGCGCCTTCTTGTCCCTCTCGCGGCGCTGCTCCGGGGTGAGGCCGTCGCCGCCGTTCTTGGAGT
TGGGCTTCCGCGCCGCGGCGCGCTCGCGGTCGCGCTCCCTCTGGCTGCCCCGTGCCCGCCCGCAGAGAAGAAAGTCAAGGAGGAAACAGATCGAGCATGA
CGAACAAGGAATATAGCAATAGCAAACAGTAATTCACAGATCCAAATTGTGATGGGAGATGGGGAGGATATGAGTCATCTTCTTGCTTGATTCCCTTCCG
CCGGCGGCGACTCTCTTCTTGTTGGGGGTTCTTTCTCTCCTCTGTCTCCTGTGTTGGAAGGAGCTCCTTCAACCTAGTTCATCCTTCTAACAAGCTGGTT
GATGTAGTTCTCACGGTTACCAGCGTCACCACCCTCAAACGTAG
page-top