Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21046  (registered. 2003)
Contig Information
Length 743 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit Os07g0185900 [Oryza sativa (japonica cultivar-group)] >gi|33146906|dbj|BAC79927.1| unknown protein [Oryza sativa Japonica Group] >gi|50508335|dbj|BAD30185.1| unknown protein [Oryza sativa Japonica Group] >gi|113610604|dbj|BAF20982.1| Os07g0185900 [Oryza sativa (japonica cultivar-group)] >gi|125557491|gb|EAZ03027.1| hypothetical protein OsI_25168 [Oryza sativa Indica Group] >gi|125599372|gb|EAZ38948.1| hypothetical protein OsJ_022431 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 1.05314e-12
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21046
TGGGAAAGAAATACAAACGGGAACAAGAGATTCAGGCAACGATTTCAACATGAGTGGAATGGCAAAATCACATCAGAAACCAAACGAATTTAACTTGCAA
ATTCTTCAATCCGTTCATTCAATCAATCAAACATTGTCTCCCATCTTTCATTTCCCTCTCTCGATTCGGAAGTAAAACAGAAGTACAATAAAAGAAGATA
ACACCTCTCCTCTCTCTTCAATGGCACGATAAATCCGGACGAGCTCAGAAGCAACCGGCCTAGACGACGGTGTAGAGAATAATCTCCGTGGCGTCGATGG
CGGCCCGCTGCTGCCTCTTCATCATGGCCATGGCCACGGCGCCTTCTCCGGGCACCATCCCGCCGCCGTCGACGGCGCCGGGGGCGGCCGAGGAGGAAGC
GGGAGGGTGGTAGTACATCCGGGCCGTCTGAGGGCAGTGGGAGTGGAACCGCGCGGCGATGCGCACCCCCATATCCAGCAGCTCCACGTACTTCCCCATG
GATCTCGCGCGAATCTGACGACCTCCTTCCTCTCTCTGCTCGACGAAGATTGATGACCGGGACGGAGAAAGCAGCCGAGAACTGGAAAGAACGGAGGGCT
TGGTAGCGCTAAGCTCTCTTTTCGTGGAACGGGGAGGCCCAGGAACTGGGGGCGGCCATGGGAGGGGTGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGANAGAGAGAGAGAGA
page-top