Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21042  (registered. 2003)
Contig Information
Length 1677 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit U2AF small subunit [Triticum aestivum]
Score 792
Evalue 4.908e-112
Total Hit Count 484
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21042
CCGATCCGCCCTGCTCCACCTTCTGCTCCCCCTCCGGCTACGGCGGCGCTGATCTCCGGTAAGCCGTCGCCGCCTCCTCCGCGCCCGTGCCCGTACATCG
CCTAGTAGATCTATACATGCATGTGTAGGTTCGAAAGGATTGGGTTGCCCGTGCCCGCGTATTACGCTCGTTCGCTTTCTCTCGGTTCAAACGGATCGGA
TTGACGATGCTTTCGTGTGTCTTCTCTGTCGATTCTTATCAGGTCGGGAGATAGGTTCTTCCCCCCCTTGCGAATCGACGAGATAAAAGTTATGGATTAG
TCTTGCTCTTGTTTAGTTCCGTTTTCTTTCGATTTGATCCGGAATTTAAGTGCCTGCTGATTTTGAAGGTTTCGTCAGTTTCCACCGGAATTGGGATGAA
TTGCATGCAGTATCAAGTTCTTGTCCCCTTTCCTTTGAATTATCTGGAATGTTATCCCGTTAATCTTGGCTGCAACTTCGTGCGTTTGATTTGTGATTCG
TGTGGTGGGAGTGCAGAGATCTCTAGCTTGCGAATCCAGGGTGCGCCGCCATGGCCGAGCACCTCGCGTCGATCTTCGGCACGGAGAAGGACCGCGCTGA
ACTGCCCGTTCTACTTCAAGATCGGCGCGTGCCGGCACGGCGACCGCTGCTCCCGCCTGCACAACAAGCCGTCTGTCTCGCCCACGCTGCTGCTCTGCAA
CATGTACCAGCGCCCCGACATGATCACCCCCGGGCGTGGACGCGCAGGGCAACCCCATCGACCCCGTCAAGATCCAGGGCGACTTCGAGGACTTCTACGA
GGACATCTTCGACGAGCTCAGCAAGCACGGCGAGGTCGAGAACCTGCACGTCTGCGACAACCTCGCCGACCACCTCATTGGCAACGTCTACGTGCAGTTC
AGGGAGGAGGACCAGGCCGCCAAGGCCCTCCAGGCGCTGCAGGGGAGGTTCTACTCGGGCCGCCCCATCATTGCTGAGTTCTCGCCCGTCACCGACTTCA
GGGAGGCCACCTGCCGGCAGTTTGAGGAGCACAACTGCAACCGCGGAGGGTACTGCAACTTCATGCATGTCAAGGAGATAGGCAGGGACCTGAGGAAGAG
GCTGTATGGGCACCTGCATAGGTCCGGGAGGAGCCACAGCAGGAGCAGCCGGAGCCCGAGCCCCTACCGTCACCATGCCAGGGACCGTGATCGCTCCTCA
CGGTCTAGGGACCGCGGCGACTACTATGGAGGTAGCTTGGACCGTGGCGACTATGGTGACTACTACCACCATAGCCGGAGGAGCAGCGAGAGGAACCGCA
ACTATGACAGTGATGGGAGCAGGTGCCGGCGACACAGGTCCAGGACTAGGAGCCCCGTCAGGGAGGGCAGCGAGGAGAGGAGGGCGAAGATTGAGCAGTG
GAACCGTGAAAGGGAGGCGCCTGCCAGGCAGGGCAGCGAAGAGAGGAGGGCGAAGATCGATCAGTGGAACCGTGAGAGGGAGACTGCTCAGGCGTGAGAT
CTCCTGTCTGACTGCAGGTTGAAGTGTTGCCTTGTTCACCGGATGTTCTGCTTGCTTGTCTGATCGTGTAATGGTAGATGGAGTTAGAATTTGGTCCTAG
TGAACTTGCTTGGATGCCTGATGTAACATCTTCAGTGTTGTTCTTGTTGAACTTCCTCTATGGATTTGTTGATGAAC
page-top