Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21023  (registered. 2003)
Contig Information
Length 825 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 3
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit cinnamate 4-hydroxylase [Citrus x paradisi]
Score 767
Evalue 1.20289e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21023
TTTTTTTTTTGTGAAAAAATCATCAATATTTTGAGGATTTAATTTATGGCAGCATCAGGAGTACATCTGACGGAAATCGTCCAGTCTTTTCCTCCCCGTT
CGACATTTCTTCAGCTCCTCTGTTTTCTTGCGGATAACATTAACGAAACGTGTGTCTACTCTGTGACGGATACTATAATCAAGTATACTTAGGACGAGCG
AACAATCGTGAAAGTACAACACCACCAAACCAAAATGCTGGAAGTCCAAACTCCAGAGCACGTACGTCGCTGCTCTAGAACACTCTGGGCTTGGCGACGA
TGGTGGAGTGCTTGAGGATGTGGAGGCTGAACTGGCCGCCCTTCTCCGTGGTGTCGAGCTTGTCCTGGCCGGGCGGCGGCGTGAGCACGAAGTTCTGGAC
GAGGCGGCCGATGGTGATGCCGAGGATGGGCAGCGCGAGGATGATGCCGGGGCAGCTCCGGCGGCCGACGCCGAAGGGCAGGTACCTGAAGTCGTTGCCG
TTGGCCTCCACGTGCTTCTCCTCCTCCAGGAAGCGCTCCGGCCGGAACTCGTCGGGCCGCTTCCACTGCTCCGGGTTGTTGGCGAGGAACCAGGCGTTGA
CGAGGATCTTGCTCTCGGCGGGGATGTTGTAGCCGGCGAGCTTGGCGTCGTGGAGGTTCATGTGGGGCACCAGCAGCGGGATGGCCATGCGCAGCCGGAG
CGTCTCCTTGATCACCGCCTGCAGGTAGGGGAGCTTGTGCGTGTCCGGCTCCGTGATCTGGTGCCCCGCGCCCAGCACCGCGTCCATTTCNTCGCGAAGC
TTCTGCTGGATCTCCCGGGTGGTTC
page-top