Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21014  (registered. 2003)
Contig Information
Length 971 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit Os12g0563600 [Oryza sativa (japonica cultivar-group)] >gi|77556167|gb|ABA98963.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649545|dbj|BAF30057.1| Os12g0563600 [Oryza sativa (japonica cultivar-group)]
Score 628
Evalue 2.0845e-63
Total Hit Count 179
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21014
CTGCAGCAAGCAAGCGAAGCTCGTGCGTGAGCGAGCGACCGAGCGAGCTGAAAAACCACCCTACAAAGCTCCGGCTGAGCCACCCGTCCGGCCGGCGACG
ATGCCGATGCTCATCCCCGACGACGTTCGCGCCAAGGCGGAGATCTACACCGGCGACGCGGCGGGGCAGGAGAAGACGCGGCTGATGCTGGCGGAGACGG
AGCTCCCCAGCGGCCTCCTGCCGCTCAAGGACATCATCGAGTGCGGGTACGTGGAGGAGACCGGCTTCGTGTGGCTCAAGCAGAAGAAGCGGGTGGACCA
CTACTTCGCCAAGGCCGGCCGCCACGTCTCCTACGCCACCGAGGTCTCCGCCATCGCCGAGAAGGGCCGCCTGAAGAAGATCTCCGGCGTCAAGGCCAAG
GAGATGCTCATCTGGGTCAACCTCCACGAGATCTGCGTCGACGACCCGCCCACCGGCAAGCTCCACTGCAAGGCCATCGGCGGCCTCTCCCGCAGCTTCC
CCGTGGAGGCATTCGAGGCCACTGACGCCCTGGCCGTGCCCGTCACCGGACGTCTCAAGAAGAAGACAGAGAAAGAGAGCACCGACAAGAAAGACGAGAA
GGAGGAGGATTCAGCAGAGAAGCCGAAGGAGGAGGCAGCAGAGAAGCCCAAGGGGGCCGCCGTCGCCCCCGCCCCCGCCGCCGTCGATGAGATCGGTCAG
AAAATGAAGGAGATGAACACGGAGGCACCCGTGCAGGCGGAAGCGGTGGCAGCCAAGAACTGATCGGTGGCGGCGACGGCGACGGCGGCACGTCATGATC
GGTTACCTAGTCATAAATTTGTTTCAGAATAACGCATTGCATTAGCATGTCATCAACCATCCACACATATGTATCACCTGATCGATCGATGAGAGTTCAG
TTCGACAACGATGTAATTTACTCCTACCTTTTTTTTCTGGTTTTAATGTGATGAAATTTAATGGATGCCAT
page-top