Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21010  (registered. 2003)
Contig Information
Length 733 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit RecName: Full=Histone H2B.1 >gi|21801|emb|CAA42530.1| histone H2B [Triticum aestivum]
Score 459
Evalue 5.04449e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21010
CAAGTCCCAACACCTTCCGGCGGCGAAGCAACCCACCCACTTTTCTCCCCCTCCCGAAGCAGCGATGGCCCCCAAGGCGGAGAAGAAGCCGGCGGCGAAG
AAGCCCGCAGAGGAGGAGCCCGCGGCGGAGAAGGCCGAGAAGGCCCCGGCGGCGAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACCGCCT
CCAAGGAAGGCGGCGAGAAGAAGGGCAAGAAGAAGAGCAAGAAGAGCGTCGAGACCTACAAGATCTACATCTTCAAGGTGCTCAAGCAGGTGCACCCCGA
CATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGGGAGGCCGCCAAGCTCGCCCGCTACAAC
AAGAAGCCCACCATCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGGGAACTCGCCAAGCACGCCGTCTCTGAGGGCACCAAGGCCG
TCACCAAGTTCACCTCCTCTTAGACTGCGTCGCCTGTATCTAGTAGCAAATGTAGTTCTATACTGTTGGCTTAGTGCTTGTCCGTGGACTCTGGTTATCT
GCAAGTAATAGTAGTCCTACTTTTGGATGAAAATTGCCGAATCATTGTAAATGCTTTGTTGGCTCGTCGGCCACCTGCAAGAACTGAATTATGTCCGCTT
CAATTGGCAAATGAAGATTTCGGAAAAAAAAAA
page-top