Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20937  (registered. 2003)
Contig Information
Length 2631 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 5
Wh_OKCS Seed DPA5 1
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_19058 [Oryza sativa Indica Group]
Score 1816
Evalue 0
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20937
TTCGGCACGAGGAGGATGCCCAAGAGTCATTGCCTGATGGATTATGTGGTGAAATATTACTTGGTTCCAGTAATGTGTTGGTAGCACTGGATGAGACTAG
GTCAGCTCTGTTTATTGTTGATTTCAAGGGTGAGAGCATCAGCTACAACAAGGTGCAGATTTCAGAGTTTGTTCAAGACTTTTCTGGGACGGTCAAACTT
CTACCACTGATATCTAATGGTATCATAGCTTTGCAATCGTCTTCTACTGTTTCTCTCCTGAAGCTTAAAGGTATGGATGGGTTGGAAGTAATCCATAGCT
TTGACCAACCAGCCTCTGTGAGTGATGCTCTGACAATAACAGAAAAAGATGAGGCCTTTGCTGTTGTGCAACATGTGGGTTCTCAAATTGAATTTATTGT
CAAAGTTACAAGTGATTTAACCAATGAGATTATTAGGGAGAAAGTTGATATAGATCAGCATAGAGGCAGTGTACAGAAGGTCTTCTTGAATAATTATGTT
CGCACTGATAAATCTCATGGTTTCCGGGCTCTGGTTGTAATGGAAGATCATTCCATCCTGTTAATTCAACAAGGTGCGGTTGTCTGGAGCAGAGAGGATG
GACTTGCTTCAATTGTTGATGTAATGACTTCTGAATTGCCTGTTGAGAAGGATGGTGTCTCAGTTGCGGATGTGGAACACAATCTCTTTGAATGGCTTAA
GGGACATGTGCTGAAACTCAAAGGAACTCTAATGCTTGCTAGTGTTGATGAACTTGCTGCAATCCAAGCATTGAGAGTCAGAAGCTCTGAGAAAAATAAG
ATGACCAGAGACCATAATGGATTCCGCAAACTTCTTATTGTATTGACCAAGGCTGGCAAAGTGATAGCTCTGCATACTGGAGATGGCCGTATTATCTGGT
CAAATTTGTTGCCTTCCCTTCGTGCTTCTAAATTGGGCGAAATGCCTTCTGCCTTGAGGATATACCAATGGCAGGTACCCCATCACCGCGTTATGCGTGA
GAACCCGACCATACTTGTTGTGGGAAGATCTGGAGCCAGCTCTGTTGCTCCTGGTGTCCTCTGTATTCTTGATTCATATTCCGGAGAGGAACTCAACTCT
CAGAGCTTTGACCATTCTGTTGCCCAAATTATCCCATTGACACTGAAGGATTCATCTGAACAGCGTCTTCATCTTATTGTTGATTCCAACTCCAACGCTC
ACCTATATCCAAGATCTCCGGATGCCCTTAATTCATTTATTAATGAAATGTCAAATCAGTATTTCTATTCTGTAGATATTCAGAAAAATGCTATCAGAGG
GGTATTCATTACAGAAATCATGCCGACTTCAATTCGGATGACACATACTGCTTTAGCACAAAGTTGTTATGGTCTATCATTTTCCCTTCCGACGCAGAAA
GGATTTCTGTCTCCGAAGCACGAAAGATGAATGAGGTTGTTCACACTCAAGCAAAGATCATAGCAGATCAAGATGTGATGTACAAGTATTTATCAAAGAA
CTTAATTTTTGTTGCTACGGTGTCTCCTAATGCTGCTGGTGAAATTGGATCCGCGGCACCTGAAGAAGCTTCACTCGTGGCATATCTCATTGATGCTGTC
AGCGGACGCATACTACACCGTGTGACCCATCATGGTGCACAAGGCCCTGTGCATGCCGTTGTCAGCGAGAACTGGGTTGTCTATCATTATTTCAACCTCC
GAGCTCACAGATTTGAAATTGCAGTGATTGAGATATATGACCAATCTAGGGCGGACAATAAAGATGTATTGAAGCTCATACTTGGGAAGCACAATTTGTC
TGCACCCATGACTTCTTATTCCCGACCAGAGGTTATGGTGAAATCCCAGTCATACTTTTTTACTCATTCGGTGAAGGCAATGGCAGTTACACAAACAGCC
AAGGGTATCACTTCCAAGCAGCTTCTCATTGGCACGATTGGTGATCAGGTTTTGGCACTTGACAAGCGCTTTCTTGACCCACGCCGTTCATTGAATCCTA
CACAACAAGAGAAAGAAGAGGGTATTATACCGTTAACAGATTCTTTGCCTATTATTCCACAGTCCTATGTGACGCACTCTCTTCAAGTGGAAGCACTGCG
AGGAATTGTTTCTATTCCGGCAAAGTTGGAGTCCACTACTCTTGTTTTCACTTATGGTGTGGATCTCTTCTACACTCGGCTTGCACCATCAAGAACCTAT
GATTCACTCACGGATGAATTCAGTTATGCTCTTCTTCTAATTACTATTGTCGCATTGGTTGCTGCTCTTTTCGTTACTTGGATTTGGTCTGAGAAAAAGG
AATTAAGAGACAAGTGGAGGTAATTGAGGCCTCAATGTTGTGATGCAAATGAAATTTCCGGCCCTAGTCGACATCCTTATCTTTGACTTTGTTAGTGCTA
GGGTTCGTTTCACTTTTGACTAGGCTATTATTTTTGTAACATTTGAAAGTGAAACCTGTTTCCTGGGATGACACTGCATAAGGTACTTGTGCAATTAGAA
ATCCTGGACATGACATCACAGAACTGGCAGATCACGCAGGACTCCTAATACGTTGTAAAATGTACCACAGCGACCAAACTTTCCACCAGAATGTTAGCAG
TGCTTTGTAACTTAAAAAAACAAAAAAAAAA
page-top