Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20936  (registered. 2003)
Contig Information
Length 1408 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit ankyrin repeat domain-containing protein 2 [Zea mays]
Score 1388
Evalue 2.67068e-151
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20936
TTTTCCTCCTCTCCTCTCCTCTCATAGCCTTCGCCGCTTCACCGCTGCTGCCTTCCCTCCCTCGCAAGCCTCCTCCGCGTCGCCGCCGCCCGCCCGTCGG
ATCCGCCATGGCTTCCGACCAGAACAAAGATTCAAAATCGGAGGGGCTGTCTGAGGCAAAAAAGGGGGCTTCCCCAACAGCTGGTGCAGGCCTTCCCAGT
CCTTTTGATTTCTCCAACATGAGCAGCTTGCTCAATGATCCATCAATAAGAGAGATGGCTGAGCAAATTGCCAGCGACCCTGTATTCAACCAGATGGCTG
AGCAGCTTCAGAAAAGTGCGCAGGGTACAGGGGAACAGGGTGTTCCAAATTTGGATCCTCAAGCATACATGGAAACCATGACACAAGTTATGCAGAATCC
TCAGTTTATGTCAATGGCGGAGCGTCTTGGGAATACTCTTATGCAGGATCCTGCAATGTCCAGTATGCTTGAGAACTTGACTAGTCCAGCTCACAAAGAG
CAGCTTGAAGAGCGAATGTCCCGTATCAAGGATGATCCGTCTTTGAAGCCAATTCTTGATGAGATAGAGCGTGGTGGTCCATCTGCAATGGTGAAGTACT
GGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCTATGTCATTGAACTTCCCAGTAGATGCTGCTACTTCCACTGTACTATCTGGACCTCAAGAAAC
TGATGAAGAAGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTCGGTGATGCAGAGGGACTGAAGAAAGCATTAGATGGTGGAGCAAAC
AAGGATGAAGAAGATGTGGAGGGAAGAAGGGCCTTACATTTTGCATGTGGATACGGCGAGTTGAAGTGTGCAGAAATCCTTCTGGAGGCAGGCGCTGCAG
TTGACGCACTGGATAAGAACAAGAACACCCCACTGCACTATGCCGCTGGATACGGTCGGAAGGAATGCGTGGATCTTCTCTTGAAGCACGGCGCTGCTGT
CACGCTCCAAAATCTGGACGGGAAGACCCCCATCGAGGTGGCCAAGCTCAACAACCAGGACGAGGTGGTGAAGCTGCTCGAGCAGGACGTGTTCCTATGA
AGCAAACCCTCAGACCCAGCGCTCGTCGATCCTAAAACTCTCCCTTGGTTCTGGACTCTCGGCGGTGTCATATCGTGGCGTGGTGTTGATTGTTTCCCCT
CAGTTTTACTTAGTCGGTAGCTCTCGCCTGTAACCTGTGTGGCCTTGCGGTGCTACTCAACAGAGTCCCATCTTCTTCTCATTTGTTTTGATCCTGCTGT
GCAACCCTGTTCTTGGTCCATCTCCATGCACGGGGGATATGGGTTCGCTGTGGGAGCTGTCAGGGGTGATGATTGCGTATATACCCCTGTCGTGAATATT
TCTTGGTG
page-top