Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20922  (registered. 2003)
Contig Information
Length 1147 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Os03g0332400 [Oryza sativa (japonica cultivar-group)] >gi|108707977|gb|ABF95772.1| Hydroxyacylglutathione hydrolase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548487|dbj|BAF11930.1| Os03g0332400 [Oryza sativa (japonica cultivar-group)] >gi|215736998|dbj|BAG95927.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192761|gb|EEC75188.1| hypothetical protein OsI_11422 [Oryza sativa Indica Group]
Score 1242
Evalue 1.70793e-134
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20922
TTTTTTTTTTCCAACCATCACAGACTTCAGATATACACAAGACATTCTGCCACAGGCCAACATAGTTTTTGTTTGTTTTGCCAAGAAATAACATACCAGT
AGTAATTAACATGCCACAACAGTTGTATTCTGATTGATACCAAAGCATATTAGCAGACTGGACTCCTTTCTCTTATGTTTTTCTTAAAGGAAACACTGGC
ATATTATCTTCTTAACACGTACGTAGCTCTCAAAGCATCGCACGGCTGTAAACGCCACCTACAAGTATGAGTGGCAGCTGCGTTTATCAACCTTTCCAGG
TATCCTTGATGTTCCTGACCGTCCTCAGCGCTTCAACTGCCGACTTGGCACCAAATTTTGCCTGTATTTCAGGCAGATCAACACGCATGAAGGTGTTTAT
CTCAAGCTCATCTCCTATAGTTGAGGGAACCGTCGGTTGATTTGCTTCACGCTGCTTTTGAGCCCATTCCAGTTTCTGCTTCATTTTTTCGTTCTCTGGC
TCGACTGTCAGCATGAATTGTAGGCTCTTTACAGTGTACTCATGGCCACAGTAAACACGAGTTGACTTAGGCAGCGAGCCCAGTGTAACACAAAGGGACT
GGTACATTTGCTCTGCCGTACCCTCGAAAAACCTCCCACAGCCAGCAATGAACAAGGTGTCTCCAGTAAATACTGCTGGGTCTTCCTCCTCTTTGCTAGT
AACGTAGTAGCTAATATGACCTTTTGTATGACATGGCGTATGTAGGCACAGTATGTCAATTTCCTTCCCAATGGATAACTTAGTTCCGTTTTCCACCTGA
TCAGTGCAGCCTTTAACATTGTCCATGGATCCCCCATAGACCTTAATCCCTGGCACCAGCAGCCTCATCTTCTCATTGCCACCAGCATGATCCCAGTGGT
GGTGGGTGGTGAGGACGCAGTCGATGTAGGCGCCGACCTCGCTGGCCGCCGCCAGCACCTTCTCCGGCTCCACCGGGTCGACGGCCGCCGCCGCCTTGGT
GCTCTCGTCAACGATCAGGTAGGCATAGTTATCCTCCAAGCAAGCCACCGGAATGATCTTCATCTTTCGATTTCTGGAACGAAATCCTGACGGAGAAGAG
TGGAAGCAGGCCGGAAGGGAGGAGAGGGTCGTGGAAGGTTAAGAATG
page-top