Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20917  (registered. 2003)
Contig Information
Length 1528 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_27366 [Oryza sativa Indica Group]
Score 1561
Evalue 2.58617e-171
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20917
CGGCAGCCGCGTCCACGTTCTTCTGCTTCGACGGCAACCTGGATCTTGTCCACATTGGCACCGACATCGAGCTCTTCGTCCAGAAAAAGCCTGGACTTAG
CGCGTACGCCCAGGACCCGCGCGAGGCTGCTCAATCGCTCGTCTCCCTCATTGAGAAGGCCAAGGAAGTGGTTCCGGCTGAATTGCGCGACCAGACGCCT
GTCAGAGTTGGGGCAACAGCAGGGCTAAGAGCTTTGGGAGCAGGAAAATCCGAAGAGATCTTGCAAGCGGTTAGGGATCTTCTTCGTGAAAAGAGTTCAT
TTAAGAACCAGCCGGATTGGGTCACAGTTCTTGATGGAACTCAGGAAGGTGCATATGAATGGGTTACCATTAATTATCTGTTGGGAAATCTGGGAAAGAC
GTACGCAGACACAGTTGGTGTGGTTGACCTTGGCGGTGGATCTGTCCAAATGGCGTATGCTATCCCAGAGAAGGATGCTGAAAAGGCTCCTAAACCAGCA
GATGGTGAAGAATCATACGTGAAGAAGCTTTTCCTTAAAGGGACAACGTATCATCTTTATGTCCACAGTTATTTGCGCTACGGATTGCTGGCTGCTAGAG
CAGAGATCTTAAAAGCTGGCAATGCCAATGGTTACAGCAACTGTGTATTGGCTGGACATCAGGGGCAATACAAGTATGGTGGCAATACATTTGAAGCATC
GGCTGCACCTTCTGGCAGTAGTTTTTCGGAATGCAGGGCTGATGTAGTGAAAGCTCTTAAAGTAGATGAAGCATGCACTCACATGAAATGTTCCTTTGGT
GGCATTTGGAATGGTGGTGGTGGTGCTGGCCAGAAGAATCTCTTTGTAGCGTCGTTTTTCTTTGACAGGGCTGCCGAGGCTGGTTTCATTAACTCCAATG
CGGCTGTTGCCAAGGTCAAACCCTCAGACTTTGAGGAAGCTGCCAAGCGTGCTTGCAAATTGAACGTGAATGACGCCCAATCTAGCTACCCTGGTGTCCA
GAAGGATAACGTTCCATACATTTGCATGGATCTTGTGTACCAGTACACACTGCTTGTGGATGGATTTGGTGTTGATCCCCAACAAGAGATGACATTGGTA
AAGAAGGTTCCTTACAGCGACGCGTTTGTGGAAGCTGCGTGGCCACTCGGAAGTGCCATCGAGGTTGCATCTTCATCATAGGCAGCAACCAGTGTAGCAT
CAGAAACATCAACGTGGGAGCATGGGCATGACCACCGTAGAAGAAGTTTTGGATTCAGGGGTCTACATTTAGCCGGTTCTGTGTGTGCTTCCCCCTGAAG
TCACCATTTTGTCGCCCGGTCAGTTCGTCCAGCCTCCCCTCCCATACAGTATAGGTTCATACGCAAGGACATGAGGATTACGGCACCAATTGTACTGCAG
CCAGACGCCATTGGAAGGCGCATTATTATTTTTGTACTGATGATGAGAGTAGACGAGAGCATTCCATTCTTTCTGACTTCCACTTGAGATGGGCATAAAC
ACATTGTTCACTTACCGTAAAAAAAAAA
page-top