Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7434  (registered. 2012)
Contig Information
Length 1197 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_DPA20 Seed DPA20 1
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 5
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 16
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637610|gb|EEE67742.1|| hypothetical protein OsJ_25434 [Oryza sativa Japonica Group]
Score 483
Evalue 3.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7434
TTTTTTTTTTCCTACTTCATCATAAACTTTACTTATTCTGTACTGAACTACAGCACATGCAACTCGCATGCCTAACACAGGACGGGTATAAATATAAGAA
CTAATGTGTGCAGAACAAAAAATATAATTACACAGGCGAAGCCAGGAATCATGTACAAGAAAGCAGCAGTTCAACAGGGGCCGGGCCTTGCAGCCTAGCG
TCAGCGAACCAATTTACAGGGGTGGTTGGTTACCTAGGCTGCAAGAGCGTGCAGAAGAATCCTCGACGGTATCTGCAAGCTCGTTTCCAGAAGATGCCTT
GGACAGAGCTTCCACAAAATTGCAGCCTTTGGTGACGTTAGTGCTTCAGAAGGACCGCGGTCTGAGAAAATCACTTTCAAGTATCGCAGTAAGAACGCTT
TCCCTCCGTTTAGCTTTGGTCATTTTGGCGATTGGGCTTTGGCTAGTATCACTTAGCAGATTGTACTGCCGTTTTTTGCCTGGCAAGTACTCTCTCAAAC
TCGGCACAAGCTTCAGGCGAGTCTTCTTCGCTGGGTGGCACCAACTGCCAGAAGAGTGGCAGATATGCCTCCCATTCGCTCAGAATTTTAGCGCCTTTTG
TGCTGCCTGTTTTTTCAACATAGGCCTCAATCAAGCCCTTGAGCTGCATCTGCCCAGCGGGAGCATTCACTCTCTGCATCTTGACAATCTCCTTGTTTAC
CTTCGGGACTAGAGTATCATCTTCATCTAACATGTAGGCTAGGCCACCGGTCATTCCGGCTGCAACGTTTCTTCCAACTTTGCCGAGTACAACTACACAT
CCACCGGTCATGTACTCGCAGCAATGATCTCCTGTGCCCTCAACCACTGCTTGCCCAAGAGAATTCCGAACTGCAAATCTTTCTCCTGTCTTGCCTCTCA
CAAATACTTGACCACCCGTAGCTCCATACAGACAAGTGTTCCCAACTATAGCAGCATCCTCAGGAACAAATCCTGTATCATCTACAGGAACTACAACCAG
CTCTCCACCAGCCATACCCTTTCCCACATAATCGTTGGCCTCTCCTACTAGGCGAACATTCATGCCAGGTGTCAGAAAACAACCAAAGGACTGCCCTGCA
CTTCCGGTGAACGTAATGTTCAGCTGGCCTGCAAAGCCTGTATCTCCGTACTTCTTAGCAATGGCACCCGCTACACGGCCGCAAACAGCCCTATCAA
page-top