Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20907  (registered. 2003)
Contig Information
Length 1177 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 3
Homology (BLAST) Top Hit unknown [Zea mays]
Score 870
Evalue 9.80693e-106
Total Hit Count 299
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20907
CCGGGTCAGTCAATCCTTCCACATAAGTCCCTTCGATGTCAAAACTTCCGCACACTGATGCCACTTAGCCGTTCAGTCCAAGAAACTCCACCTCCTTAAA
ATTATCAATGCATTATTGAAAGATTACAACAGCATTACAACAGAAAAAACTTGTTCTCTGGTGGAGCACACCCCTAGTACACCCTACATCAACGAAACAA
AACAGAGTTACAGATATAGTTTATGTACACAACGAACTGGATGGTGCCGCGAGGCGGTGCAGTCAGTCAGTGGGCAAACAATGCAGATTCAAATCTCCTC
CCTTTGTATGCAGCACTCTACTGATGCCTCCTCACTCCAGTAGCCCCATATATCCTTAGAACTGCAATTTTTGCATATGTTGGGTACCACAGCTGTATGA
CCTGAGAGGATTCTTCTCGATCGACGGAGCTAAGATGTTAAACAAGGACTGACTACTGCTATCGGTGTTGGTGGTCACAAGCCTGGCAGGCCTTGGCCGA
TCTGGGGTTTACATATGTACACTGATCACACGTCCAAATGTTGCTATCGTCCACGCCACGGCTGGAGCTGCCTGATTTGGAGCCGGCAGCGGATGCCCTG
TTCTTACCACTCTTGCTCTTACCACCAAGGCTCTTAGAAGTAGTGTTCTTGATGCCCGTGCTTTGGCTAGTAGAAGGTCCAACGTCATTTAATCCAGTCT
CCAGTGCCCGGACAAGATTCTCAAAATAATTGCGAGTCACGCTAGTTAATCCAGCCAACTTTGTACGGAAGTCATTGAAATCTTTTGAGGGGGACTCGGC
TTCAAGGTATATTTGAAGTTCTTTCTCTGCACACTGATGCAGCCGCTCCAAACCTGATTCAGCCTCACCTTGCAGATATTCGAAAAACTGTCTTTTGGCA
TGTTCGTGCTCTGGGAGGTAATAACCATAAGCATATGTCCACTTCAATACCCTCCTACACTCAACAATCTGTAGCCATGCCTCTATGATGAACTTGAGCT
GTGACTCAGGTTGACTTTGTATATCACTTAACTTTTCAAGCTTGTCATTTTGCAGACTCTGAAGGTCTCCTAATGCCTTTTGCCCTTGATGACTGATTAG
CTGCCCATCGTTCATAATAATGTGTATATCTCTCAAGGGAGTTCTTCGCCATTTCTCTTCTCCTTTCAGATTCATCA
page-top