Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20895  (registered. 2003)
Contig Information
Length 1418 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 6
Homology (BLAST) Top Hit hypothetical protein OsI_00492 [Oryza sativa Indica Group]
Score 1017
Evalue 5.60953e-169
Total Hit Count 421
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20895
GGAGCCTGGTCCACCTTGCAAACTGATCTGCGGGGAACAACTTTCTTGTGGCCACAAGTGTAAAGAAAGGTGTCATGGCTCTATTCCTCCACCGAACCCC
GAGTTCACAGTTAAACCAATGAAAAAGAAAATGGAAAAGCATATAGAATGTACGCCTGGAACTCCATGCCCACCATGCCAAGAAGTAGTCTTGGTGCCAT
GTTTTGGAGAGCATCTAGGCCAAGAACGTGCAATACCTTGCTCCAAAAGCAGGCAATTTCCCTGTCAGAATTTATGTGGAAACCTTCTCCACTGTGGTAA
CCATTACTGCACAAAGGATTGCCATGTGTTAGAGATTCCATCGGATCAACGTAAGGCTGATACCATATTATCTCTCAGTAGAAAGAACACTCTTGCCGAG
CCTTGCGAAAGATGCAATCTTCCTTGTCAAAGGGCCAGGGATCCTCCTTGTTCACATCCTTGCCCTTTGCGGTGTCATCTAAGCGATTGTCTACCTTGCA
AAGCCCTTGTTAAAAGATCATGTCATTGTGGTGCTATGACACATGCTTTCGAGTGTATGTACTATAACAACTTAAATGCCAAGCAACAGCTGAAAGTGAG
GTCCTGCGGTGGCCCGTGTCATAGGAAACTACCAAATTGCCCCCACTGTGCTCAGAAATATGTCACCCTGGTCAATGCCCGTCAGTGGATCAGTGCATGA
AAAAGGTTAATGTACGTTGTGCATGCAACACCCTGAAAAAAGAGTGGGTATGTCAAGATGTTCTCAAGGAGTACCGAAGGTCTGGTCGTGACCCAAAAGA
AGTAGCAAAAGGCCAGTTTGGAGTTGGCCTAATTGCATGTGGTGGAGATTGTGTGAAAAAGGTCAATGTTCCAGCTGCAGAGTTACATCAACGGAAAGTT
CAGGAGAATAAGAACCCTGCTGCAGAAGTCGCAAACGTGCCCAAACGTAGGAAGAAGCGTGACCGCGGAGCACAGGAACCTGTTCAGGTTTCAATGTGGC
AGCGAATCAAGTGGTATCTCGTGGTGATAACTGCGTTAGCTGGATTGGTGGTGCTGGGACTAGTTATTTGGAAAGGCGTCTACCAGATTTCGGATTGGAT
GAACGAAATGGAAGAGCAGAAGGCCAGGGAAAGGCTTCTGAGGGCTGAAAGGCTGTAAAAAGTACAGAACTATAGATTGACTCTTGTTGTGCCCCCACTT
ATCAGTTTTTGAGACGACCGTTTGACGCCGCAGTCCAGTTTTGGAGACATTTAAGTGAAGGTTGCCATTCTTTCGCTCCCTCGTTGTATCAAAAGGAAGA
TGACTGTTGTATTGTGTCTGAATTATGTTGTTGAGTCGCTGTAAATGCACAAATGATATCTGCCTAATATATGGGTGGTGAAAACACTTAGGAGTCCGCA
ATTTTTTCAAAAAAAAAA
page-top