Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20867  (registered. 2003)
Contig Information
Length 1130 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 5
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsJ_005318 [Oryza sativa (japonica cultivar-group)]
Score 1532
Evalue 3.92899e-168
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20867
ACGACATAAGTTTCAGATCCAACCGATAACACTGCATCACAGTACTGTAGAAACAAAGACACCAACAGCAGAACCAGACGAGACACCCGACAACTCTAAC
AAAGGCACCAAGGCTTGCAAACCCAGAAACAGAAGCACCATTGCCAGGAGCTTACTGGCCACCACGGAGCCGGAGCACCAAATGAAGGGTGGACTCCTTC
TGGATGTTATAATCAGCCAGGGTGCGGCCATCCTCAAGTTGCTTACCAGCAAAGATGAGGCGCTGCTGGTCCGGTGGGATGCCCTCCTTGTCCTGGATCT
TCGCCTTCACGTTGTCAATTGTGTCCGAAGACTCGACCTCCAGTGTGATGGTCTTGCCAGTGAGGGTCTTGACGAAGATTTGCATACCACCACGGAGCCT
GAGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCTGCAAGGGTGCGGCCATCCTCAAGCTGCTTGCCGGCAAAGATGAGGCGCTGCTGGTCC
GGCGGGATACCCTCCTTGTCCTGGATCTTCGCCTTGACATTGTCAATGGTGTCAGACGACTCAACCTCCAGTGTGATGGTCTTGCCAGTGAGGGTCTTGA
CGAAGATTTGCATGCCACCACGGAGCCTAAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCGGCGAGCGTGCGGCCATCCTCAAGCTGCTT
GCCAGCGAAGATGAGGCGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGAATCTTCGCCTTGACGTTGTCAATGGTGTCAGATGACTCGACCTCAAGG
GTGATGGTCTTGCCGGTGAGGGTCTTCACGAAGATTTGCATGCCACCCCGAAGCCTTAGCACAAGGTGGAGGGTGGACTCCTTCTGAATGTTGTAGTCAG
CCAGGGTGCGGCCATCCTCGAGCTGCTTGCCAGCGAAGATGAGACGCTGCTGGTCTGGAGGGATGCCCTCCTTGTCCTGGATCTTAGCCTTGACGTTGTC
GATAGTGTCCGAGGACTCAACCTCAAGGGTGATGGTCTTGCCAGTGAGGGTCTTCACAAAGATCTGCATCTTGAGGAGGAGGACGAGATGGCCTTCGCTT
CGATCTGTCGGAGGAGATTTCCGGCGAGAT
page-top