Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20863  (registered. 2003)
Contig Information
Length 1056 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit 20S proteasome beta 5 subunit [Triticum aestivum]
Score 1372
Evalue 1.26903e-149
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20863
TCTATAACATTCATCAGTCTACAACCACACTGCCATACCAGATGCGTAAGTCGAACATCAGCAGGTCTCAGAAGAGAACACTCTAATGTCGAGGAGGAGA
CAAACAAGCCCCCAGTCCATAAAACAAGGTGCTTCAGCACAGTTCACGGAATTTCGTACGACATCAATCAGGTTGACGCAGAAGGGGCCTCGGCCATCTC
TTGCTCGACGGGAGCCGCCTGGACTGGGTAGTAGTGGTAGTGCAGCTCCCCAACATCATCTCCAGACAGCTTCTTCCAGCCGTCAGGGCCAACGTAGTAG
ACACTAACACAGCCACCACTGGCTCCGTCACGGAATGTTGCATGATAAATAGCCCGCCGTGCTAACTCAGCAGCTTCCTCAACTGACATGTTGAATTTGT
AACCCTCATCCAAGATACCATAAGCATATAGAGAGCCAGAACCAACAGAGAACCGGCTTCCCTTGAGCCTTGCACCCTCACTGTCAACATAGTACAATCC
CGGACCAGTTTCATCAAATCCAGCAATCATTGTACCGATTGAAAGTCCCATCCCGCGGTACGAGTAAAGGATATTAGCTAACGTCTTTGAAGAACCAGCA
ATAGAGATCCTTCGCTTGTTGGCAAGCTCATGGAGCCGGCACTTTACCCCCAAGTTTCTATGCCAAAACTGGCAATCAGCAGCACCTCCAGCCATGGTTC
CCAGCATGTAGGGATTAATCTCGATGATTTTCCTCACAGTTTGCGAAGATATGTAGCCGCCCATGCTGGCCCGGGAGTCGGCGGCGACGATGACGCCCTT
GTCGAAGATGAAGGAGAGCGTGGTGGTTCCCTTCTTGTTGTTCACCATCTCCTTGGTCGCCTTCTGGAACCCATCGAAGTCGTTGCAGGTGGGGAACTCG
AGGGCAAGCTGGTCGGCGGCGTCGGCGGAGAAGAGGGCGCCGAGGTCGTCGCTGCCGGCGGCGGCGGCGCCGAAGTGGTTCTGGAGGGCGGAGAGGTTGG
GAATCATCGCGTCGTCGGCGTGGGGGTGCTGGGGGACGGAGGCGATGAAGTGAGCT
page-top