Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20858  (registered. 2003)
Contig Information
Length 1384 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1485
Evalue 1.47737e-162
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20858
TGTGCTCTGCAGTTGTACACCTAACTGACAGAACACCAAATGTGTATGAGCAGCAGGAGCAACAATCTGAAGTTGTAAACTATACAGCCGGATGCAAAAT
AATCCAGGGGGCATTACAACATCACTGACAAGTTTTAGTTACCTACAATACACAGCAGCAAGCAGGTCGATGCATGGGCAGATTTATGAGACCATAAACA
CATGCCAAAACGAAGAGGTTTTATAGAACATAGACCATGCCGACCTCCAGGAGCGACGCCGGCGGCACCCGCAGCACCACGTCCGGGCCACGGCAGTTGC
GCCGGAGGAAGTTGTACCCGACCACCGTCAGCTTCTTCACCACCGAGGAGCCAGGCTTGCACTGCACGTGCGAGTGCCCCAAGATGAAGGCAGTGCCGGC
CTCCCTCGCCGCCGCCAGCGCCTCCAGCTCCTCCGCCACCTGCTTGTCCGCCTCGGGGCTCACCACCAGGCTGTCTATGAAGAACCTCACCTGCTTGGAC
GAGTTGTACTCCAAGCCCGTGCCGCCGGGGCTGTCGGCGACCTCGACGGACGCGGCCGAGTGCTGGACACTGTCCTGCAAGTCGTAGCTCGCGTGATCAC
GGAGCGTGTTGCTTCCGATGACGGTCAGCCCCGGCTCCCACTCCTCCAGCTGCTCGCTCTGGCTGACCTCGCTGCACCGGTAGGAGGCGTTGAGCTTGAT
GAACATGGCCAGGCTCTCGATGAGCTCCGTCTCGAACGAGTCCACGTCCTGGTGAACATCACGGTAGCCGTACCGCACGATGCACCGGTACGACCGGTGG
CCCGGCGGACCCACTCGGCCGACGAGATAGCGCTCGGCGGGGAACACGTACGGCACCGGGACCGACTTGACGCACACGAAGACCAGGACCTTATGGAACG
CCGGGAGGTTGGTGACGAAGCGGGAGAAGTTGGCAGGGACGCCCGACGTCAGGTCGGTGTAGACGAGGCCAATGCCCGGCACACGGACCATGCCGAGCTT
GTCACCCAGGGCCAGAAGCCACTCCAGGGTCACCTTGTTCTGCAGGTCGAACTCGTACTTCTTGATGGTGGTGATGTGCCACACGAGCATGACGGCCATG
AGGATGAGGGCCAGGAGTATAGGGAGCCAGGCGCCCTCCAGGAACTTGATGAGCGACGCCGAGAAGTAGAGCGCCTCCACGGAGCCGAAGAAGAGGAGGA
AGCCCAGGGCCAGCAGGGGTGGCTTGTGCCAGCACACCATGATCACAAGGGATGTCAGGAATGTGGTAACCAGCATCACGGTGATCACTGCTAGTCCGGA
TGCGTTTCCCATGTGCTTAGTGTCTCTGAATCCAACAGTCACGGCAATGCAGAGGATCATGAGTAGCCAGTTGATCTCAGGGAT
page-top