Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20853  (registered. 2003)
Contig Information
Length 1230 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit putative beta-expansin [Triticum aestivum]
Score 1453
Evalue 6.4956e-159
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20853
CTAGCTCGCAGCCTCTAAATTTTCGAGCTCCTGGTGCCAGTGTTTGCTAGCAAGCTACAAGCAGCAGCAGCAGCAGCAATGGCGAAAAGTTGCACCTTAG
CGCTACTTGGCGCACTCCTGGTGCTCTCGCTTCTTGTGAGCCCCATTGCTTGCTCCCGCAAGCTCGCCAAGGCGGCGGGGCACCACAAGCCTGCTCCAGT
CAAGGGCCACAAAAACCAGACCACCACTAACCCCTCCTCGTCCGCCGCATACGGCGGCGGCTGGTTGCCCGCCGGCGCCACGTATTACGGCAACCCCAAC
GGCGACGGGAGCGACGGCGGAGCGTGCGGCTACCAGACCGCTGTAGGGCACCGGCCGTTCTCGTCGATGATCGCCGCCGGGAGCTCCCCTCTGTTCATGG
CGGGCAAGGGCTGCGGCGCGTGCTATGATGTTAAATGCACGAGCAACTCGGCCTGCTCCGGGAAGCCTGTGACCGTGGTCATCACCGACCTGAGCCCCGG
CAACCTCTACCCCGGCGAGCCGTGCCACTTCGACATGAGCGGCACCGCCCTGGGCGCCATGGCGAAGCCCGGCATGGCCGACAAGCTCCGCGCCGGCGGT
GTCATCAGGATGCAGTACAAGAGGGTGCCATGCAAGTACCCCGGCGTCAACATTGCCTTCAGGGTGGACCAGGGCGCCAACCCCTTCTACTTCAAGACCC
TGATCGAGTTCGAGGACGACGACGGCGACCTCAAGGCCGTGGCCCTCAAGGAGGCCGGCAGCGGCGCCTGGACGCCCATGGCTCAGGACTGGGGCGCTCT
GTGGCGCCTCAACAATGGCAGGCGGCTGCGCGCCCCCTTCTCGCTCCGGCTCACCTCCGACTCCGGCAGGAAGCTCGTCGTCAACAACGTCATCCCCGCC
AACTGGAAGGCCGGGGCCACGTACCGCTCCCTGGTGAACTACCCCTGAGTCACGTCACAGCCATATTTACCTGCTCCATGTGTGAATTTTATATACCGCG
AAAAGAAAGAATGTGCGTCCGGGTGCTGCGAGAGGCGGCGTCAGATGAGGAGGAGGAGCTCGCAAAATTGTGATGTTCCCTCCCTGGTCTCTGCATTCCC
CTAGTGATGTATCATGTGTCATTAATCCATCTGTAATTTCCCCTTTTTTGCCTTCCTCTGCTTTGTCGTCGAGGAGACGATTGAACTGCAGCTAAAATGC
TGCATGTCGATGTACCAAGTTGTGTGCTTT
page-top