Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20850  (registered. 2003)
Contig Information
Length 595 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Homology (BLAST) Top Hit glyoxalase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|125585786|gb|EAZ26450.1| hypothetical protein OsJ_009933 [Oryza sativa (japonica cultivar-group)]
Score 506
Evalue 1.12446e-49
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20850
TTTTTTTTTGTCANTGGACACGGNGATTTATTATTTGNTATNGACAGTAGCATTACTAGTCATTACAGTAGACAGACACGAGCAAGGATGCCACTACTCG
CGGACGTGGCTCCCAAGGCGCACGGTGATCCCGTCACAGTCCCTGACGTAGCCGACCTTCTGCCCCCAGTTTTTCTGCTCCGGCGCGCTCACCGGCACCG
CCCCGTTCTCCACGGCCCGCCGGTACGCGGCGTCGACGTCGTCGTAGTCGAAGCAGATCTCCACGGGCCCTCGCTCGCGGGGCGACTTGGGCAGCTGCAC
CTCGCCCGTGAGTGCGTCCGTCTCCCTCTGGTGCAGCGGCGTGAACGCGATGGTCGTCGAGCCGGTGTCCAGCTCCGCCCACTTGTGAGAGTCGTCGACG
CGGCGGACGCTGTAGCCGAAGGCGTCGGCGTAGAAGGCGGCCGACTTGGGCACGTCTTTGACGTAACACACGATGTACGCGAGCTTAGGTCTCACCGCCC
CAGACGCCATGGCTCGTCCCTTCCGTGGGTACGGGTGCTACTGCTAACCACTTTGAGATGGCTCGGTGTTTGCCTTAAGCCGTGTTGCGTCTTCC
page-top