Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20842  (registered. 2003)
Contig Information
Length 615 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 4
Homology (BLAST) Top Hit oxidoreductase, 2OG-Fe oxygenase family protein [Zea mays]
Score 280
Evalue 1.92793e-23
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20842
TTTTTTTTTTACATGAACGGCAACATCTATGTATGTATGCATCCAGTTCTTTCTCCGAACCAGAGGGAGGAGATACACAAAAAAGAAAAGTTTTGATTGA
TTCATTCTGACCTCACCTATCCCTACTCATCATCATCATATTTCTACGTACCGCATCGGCCCTGTGCTACCCACAAGGCCACAAACTCAACTAGATTACA
GGCAGACCAGACCAAACCCCACAACAAGGAAAAAAAGAAACACCAGCACCAACGAGAGTCACCAAACAGAATACACAGGGAGGGAGGGAGGGCACGCTGC
CCGTGCGTTTTCCGAACTTTTTGCCTCGGAAGAAGAAAAACTGCTCCACGAACCAACCGGGGATGTACGACGGCCTATCGATCAGATCCAACGGCTATGC
CGGCGGCGAGGTGAGGTGCGGTCCGGCCGTTTCAGCCCTGCGACTCTATGGGCGACATCATCGCCGAGAACCGGCGCTTCTGGATGCGCGGGGGGAGGTG
CTTGTTGTACCTCTTGGGCCCAACCGTCCACGGCAGGAACACGCCGGTGCCTCCGCGCCCCATCCTCTTGTTGATGTTGCTGGAGGGCGCCATCACCATT
GGCCTCGCCGGCGCG
page-top