Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20833  (registered. 2003)
Contig Information
Length 939 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein OsJ_028727 [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.73322e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20833
AACACAAACAAACGTCACAGGGTATCCACGAGGATGCCACAAGACAAGATGCACCTTTTTAAGCTACACAATCAAGCAATATATGTCACCTTTGCAACCA
CATCAGATAAAGCATCGATTGGATCACACAGCAGGAATAATCATACATGGCTATCAAGCATATGTTGCGCACATGATTATGGGGCACCCAGTCCAGCACT
TTACTTGAATTATTATTTGTCAACTTGAGCATCCAAAAGGAATGCAGAAATTGCATAATCCATTCAAAAGGAACCATATTAGGACACGGCGTAGTAGACT
GGAGACGGCTGGCTAACCCATGGTGCAGCAAAGGCTAACAAAGCAGAGTTACATGACGAAATTGTTGAAGATCATACACTACGTGCTCATGATCTTAACA
GAAGCACAACAAACAAATTCTTTTGCCTTGCAGCACCACTCCATATGCCAGAACAGAAAATCTATCACGCCTCCAACGAAGGTTCTGTAGGTGCTTCAGC
ATCACCTTCAGCAGCATTGGGATCATCGACAATCGTGACACCCTCAAGATCCAAGGGACGGCCAGTCATCGGATGAATGGGGTTCCTGTCACGATGTCCA
CCCTTCCGGCCCATGGCTAGCAACGGAGGCGGCGGCAGAACACCGGCACGGAAGAGGATACGCTGCACGGGATCTGATGGCTGTGCCCCAACAGATAGCC
AGTACTTGACCCGGTCGAACTTGAGCCCCATCCTCTTGCCACCATCCTTCCCGGGGAGCGGGTTGTAGTAGCCGAGGACCTCGAGGTGCTTGCCGTCGCG
CGGGGAGCGGCTGTCGGCGGCCATCACCCGGTAGAAGGGCCGGTTGCGGCAGCCGAACCGCGCGAGCCGGATCCGGACCACCATGGTCGACGCTTTCTTC
TTCCCTTCCTCGCCGCCGGCCTGCGGTTCTCCGGGTGAG
page-top