Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7426  (registered. 2012)
Contig Information
Length 1437 bp
Clones alternative view 67 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_SH - 5
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|548603|sp|P36213.1|PSAD_HORVU|PSAD_HORVU RecName: Full=Photosystem I reaction center subunit II,"
Score 415
Evalue 8.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7426
TTTTTTTTTTAACAAACAAAATACCACTCATTTTTTTTTTGAAAAGAAGCCGATCATGCATATGAACAACGTTAACATACAGCAGTATCGTCATCAAATT
ACCATGTACATATAACCTGATGCATCATTATCACCGATCGAATCCAGCATTCAAACTCGACAATTAAAATTACAGGACGTCCATCATCATCGCCACCCGC
CAATAACTACCGGTCGATGAACTAGCACGTACGCATATACGACGTACGAGATTAGATGTCGAAGGAGTTCTTGCCGGTGAACTTGACCTCGATGGGGCTG
ACGTTCTTGCCGATGCTGCGGAAGTTCTGCCCCACGCCCTGCCTGCCGGCGTTGACCTTCTCCGGGTAGACGCCGTCCTTGGGGTGGAGGTACTGCACCT
CGCCGTTGGGGAAGACGCGGTAGAACTGGTAGGCGATCTTGTACTTGGAGCGGAGGCGGTTGCCGAGGGCGAGGCACTGCTCCTTGCGGGCGAGCTTGAG
GAGGTTGGGGCCCTCGCGCATGATGGCGGCGCCGCCGGTGGGCATCTCGAACACCTGCTCCTTGGGGGAGGTCCAGGTGATGACGTAGAACTCCTCGACC
TGGGCCTTGCGGAGCAGGCCGCCCGTGCTGCCGCCGAAGATCGGGGACGGGGTGGACGGGTCCAGCTGCGGCGGCACGAAGCCCGCGGGCGCGGGCTCCG
CCGGCGGCGCGGCGGGGGCGGGGGTGTCCGGGGCCGCGGCGCAGAGCGGGGCCGGGCCGCGGGCGGAGGATGGCATGGCGAGGGTGGCGGGGCGGGGCTT
GGCGGAGGGCGACCAGGCCGCGGTGATGAGGTGGCGCGTCGCCGCCGAGGCTTGCGTGGCCATGGCCATGGCGGTGGCGCTCCAAGCTCGGTGGTTCTTG
GCGAGAGAGGAGATGGGGAGAGGGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACACTAATGCGCCCGGT
ATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCC
GGAATCGAACCCTAATTCTCCGTCACCCGTCGCCACCATGGTAGGCCCCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCG
GCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCGGATCAGCGAGCAGAGCCCGCGTCAGCCTTTTATCTAATAAATGCGCCCCTCCCAGAAG
TCGGGGTTTGTTGCACGTATTAGCTCTAGAATTACTACGGTTATCCGAGTAGCACGTACCATCAAACAAACTATAACTGATTTAATGAGCCATTCGCAGT
TTCACAGTTCAAATTGGTTCATACTTGCACATGCATG
page-top