Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20823  (registered. 2003)
Contig Information
Length 577 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|113649386|dbj|BAF29898.1| Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|125536811|gb|EAY83299.1| hypothetical protein OsI_38508 [Oryza sativa Indica Group] >gi|215768129|dbj|BAH00358.1| unnamed protein product [Oryza sativa Japonica Group]
Score 336
Evalue 5.41238e-30
Total Hit Count 112
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20823
TTTTTTTTTTACCTTGGATATTTGAAGTTTTATATAATTTTAAAGTTTCAACTTGCACCATTTAGTTTCAAGTTTAGACTAGGTTCTTGGTAACAGGAGG
TAAACACGACTGCACAAGATTTAAATCTCTACATAACATCATCAGGGTCGAAGTTTGCTACAGGGTACAGATATGATATTGCCTCCCAAACACATGGATA
ATAAATCTCTGATAATGATAGTCTTGTTTTTAGCTCGATATTAAGCCATCCCACCACTAGTAGCCGTCCTGATAATCTGAAACAAGGATGATCCTATGAC
GACAAAGATGAAGAATCCAAGCACGATGGGTCCAACAGGATAGTCATTCCCCTTCTTCACAGTAGTTTCAGGCACTGAGCCCCTCTTTGTAATGTTCTTC
TGAAACTTCGCACTCTTCCTGTCAGCAAGACGCCTTGAAGTAGTCATCCTTGCTTGGCGGGGCAGGGGAGCTCGCCGGAGACGATGTAGGCAGCGGACGG
CGTCCGCGGGATCGGAGCAGGTGCCGGAGGAGAAATGGGAGATGCCGGCCTCGTGCCGAATTCGGCACGAGGANAGA
page-top