Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20822  (registered. 2003)
Contig Information
Length 1739 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit putative glycosyltransferase family 47 [Triticum aestivum]
Score 1530
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20822
ATTCGGCACGAGGCCGCTCTGATTCTTCTTCAAGCTCGGCCTCGGCGTAGGACAGGCCCTCCTCACCTTCCGCCGCCACCAAACGCTTCTTGGTGGGACA
AGCAAGGAATTGCCGGAAAAGCCTCTTCCCTGCCCCCCGTTCTCTTCTTCTTTAACTAGCCTTGGCGATTGCCTAGCGGTTCACAAGGGCGGAGCCGGAC
GGAGAGGGGCAGGTTTGTGGGGATCGGGAAGATGATGGCGAGGCGGGCCTTGGTTGCCATTGCGGTTCTTGCGGCGGCGGCGGCGCTGCTTGTTGCGGCG
GAGGCCCAGCAGGCGCCGGCGCAGCAGGGCCACCAGACAGAGAGGATCTCAGGGAGTGCTGGTGACGTGCTGGACGATGACCCTGTTGGGAGGCTCAAGG
TGTTTATCTATGACCTCCCTGGAAAATACAACAAGAAGCTGCTGAAGAAAGACCCAAGGTGCCTGAACCACATGTTCGCCGCGGAGATCTTCATGCACCG
GTTCCTGCTGTCGAGCGCGGTTCGGACCACTAATCCCGAGGAAGCGGATTGGTTCTACACACCTGTGTACCCGACATGCGACCTGACGCCTTCGGGTCTC
CCCTTGCCCTTCAAGTCTCCGCGGATGATGCGCAGCGCGATCGAGCTGATCGCGACGAAAATGGCCTTACTGGAATAGATCGGAGGGGGCAGATCATTTC
TTTGTCACGCCACATGACTTTGGCGCTTGCTTCCATTATCAGGAAGAGAAAGCAATTGGGCGAGGAATCCTTCCCTTGCTTCAGCGTGCCACACTGGTTC
AGACCTTTGGACAGAAGAACCATGTCTGCTTGAAGGAAGGCTCCATCACAATTCCGCCATTTGCGCCTCCGCAGAAAATGCAGAATCACCTTATTCCTGG
CGAGACCCCTCGATCCATCTTCGCATACTTCCGTGGTTTGTTCTATGACACCGGCAATGATCCTGAGGGTGGATACTATGCCAGAGGTGCTCGTGCATCT
GTCTGGGAGAACTTCAAGAACAACCCGCTGTTCGACATCTCAACCGATCACCCACCGACATACTATGAAGATATGCAGAGGTCTGTGTTCTGCCTGTGCC
CATTGGGCTGGGCACCATGGAGCCCCAGACTGGTGGAAGCCGTGGTTTTCGGCTGCATCCCGGTGATCATCGCAGACGACATCGTCCTGCCCTTCGCGGA
TGCCATCCCATGGGAGGAGATCGGCGTGTTTGTTCCTGAGGAGGACGTCCCGAGGCTGGACAGCATCCTGACATCCATTCCAACAGAGGACATACTGAGG
AAGCAAAGGCTTCTCGCAAACCCTTCGATGAAGCAGGCCATGCTGTTCCCCCAGCCAGCTCAAGCAGGAGATGCGTTCCATCAGATACTTAACGGGCTTG
CCCGCAAGCTTCCGCATGGCGAAGATGTCTTCTTGAAGCCCGGCCAGGCCCGTCTGAACTGGACTGCTGGCCCGGTGGGTGACCTGAAGCCGTGGTAGCA
TCTCTCGCATCGCGGTTGGAGATGTATAAAAACCTTTTTGAAAATAAACATTTTCAGGCCTGATATACTTTGCGCCTTTATACCGCCATGGTTGCACAGT
GCTGACCATAAGTCAAATGTACATCTTTTTTTCTTTTACCTTCTTTGCTGATAGCTAGTATACCATAGAGCTTCATCCCTTTTTTTTCCCTTTCTTCTTT
TTATATTAGTTGATGAAATGTGTCAACCATTGTGCAGTT
page-top