Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20795  (registered. 2003)
Contig Information
Length 921 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit putative frataxin [Oryza sativa Japonica Group] >gi|215768631|dbj|BAH00860.1| unnamed protein product [Oryza sativa Japonica Group]
Score 726
Evalue 8.34089e-75
Total Hit Count 324
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20795
TTTTTTTTTTTTTTTTTGCACGCAAACGGTTGATTATATAACATGAAGTATCACAGGCCTATGTCCCGCTATCGACGAAAACCAGACCTCTTATTAGGCA
ACGCATACGAGCATATGGTGCAAAAATGTGCAGTACAACAACTCTGTTGGTTCACTTGGCAGGATCAACATACTGAAAGACGTCATCTCGTTTACTCCCT
CGAAATGTTGTATGCCCCATTGGACTTAGCTATGTGGCATTTTCCTATCCCTTTATGAAAGGTCTACTGGAGTTCCACAGAGCTCACCGATCTCCTTCTC
TAGAAGTCGCATGAGATTTACTCCAGTCCGCCTATAAATCCAACTGTCTGTTGCTGCATCCCAGTCAAATCTAGCAGGCCCACTCACAGGTGAAGATAGC
CAGATTTGTCTGTTTGGCGTTTGCTTGTTTACAACATAGGTCCCCAAATCGCCTAGCCTCAATGTTAGAACTTGATTCCCATAATCTATGTCGAAGCCAT
CCATCTGCTGAGAATCACCATATTCCTCAAGTTTTTCAAGCAAATCATGTATTGTATCATCTGCTAATTTATGGAACTTATCCTCTGGCATTATCAACTT
GTGGTCCACCGCGGATGGGGCGGGCACATCTCCGGCGGACTGTTGAGCCGGAGGGGTCGACGAGAAGACCCTAGAGGAGAAGAGCAGCGCCCACGGCGAT
CCACCTGACGGCTTCGTCGCGGCGGCGGTGGTGTGGGAGGCAGAAGTGGAGGCTTCCAGGAGGGGTGAGGCCCGGAGGAGTACAGGGGCCCGAGAACTGG
CTCGCCTTGCTGCTGTGAGGCCGAAGATGAGCTTCCGCGCCGCCATCGCCGCCGGCGCGCCGTCGATGGAGAAGATCGTGTGTGTGTCGTGGACCGTCCC
AACTCGGCCCTCGTGCCGAAT
page-top