Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20794  (registered. 2003)
Contig Information
Length 1741 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 3
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit hypothetical protein OsI_21277 [Oryza sativa Indica Group]
Score 1204
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20794
CGCCTCTAGCAAGTGGTGGCCTGGTGGCTTGGGAAAAGCTTCCACTCATGCAGTTGTGTATGCTCGTCTCATAACGGAAGGAAAAGACTATGGCATACAT
GGTTTTATCGTGCAGTTGCGAAGCTTAGATGACCACTCTCCTCTTCCTGGTGTGACTCTCGGTGATATTGGTGGAAAGTTTGGCAGCGGGGCATATAACA
GTATGGATAATGGTGTTCTGCGCTTCGACCATGTGCGCATCCCAAGGGATCAAATGTTGATGAGGCTTTCCCAAGTTACAAGGGAGGGAAAGTATGTGCA
CTCAGATGTACCAAAGCAGCTGCTATACGGGACAATGGTTTATGTCCGTCAGACAATTGTCGCAGATGCTTCCAAGGCTTTGTCCCGTGCTGTTTGCATT
GCTGTAAGGTATAGTGCTATCCGGAAGCAGTTCGGTTCCCAAGATGGTGGCCCTGAGACTCAGGTCCTCAATTACAAGACTCAACAGAGCAGGCTCTTCC
CTTTGCTGGCTTCAGCTTATGCATATAGATTTGTGGGTCAGTGGTTGAAGTGGCTATACACGGATGTCAATCAGAAGCTGGAAGCTAAGGATTACTCAAC
ACTGCCAGAGGCTCATGCCTGTACTGCTGGGCTCAAGTCCGTGACAACATCTGCAACAGCTGATGCGATTGAAGAATGCCGAAAGCTCTGTGGTGGGCAT
GGTTACCTGAACAGCAGTGGGCTCCCCTGAACTTTTTGCGGTCTATGTTCCTGCCTGCACCTATGAAGGAGACAATGCCGTTTTGCTGTTGCAGGTTGCA
AGGTTTTTGATGAAGACGGTCTCTCAGGTGGCCGCTGGGAAGCAACCTGTCGGCACCATAGCTTACATGGGCAACATACAGCACTTGATGCAATGCAAAA
GCGCTGTAAATACAGCTGAAGACTGGCTCAATCCCGCTGCCATAAAGGAGGTGTTTGAAGCTAGGGCCCTGAGGATGGCGGTGAACTGTGCCCAGAACAT
CAGCAAGGCGCCAAGCCAAGAAGAAGGTTTCTCCGAGCTGTCCCCCGACTTGCTTGAGGCTGCTGTGGCTCACGTCCAGCTGATCATTGTGACCAAGTTC
ATCGAGAAGCTGCAGGAGGACATCCCTGGCCCCGGGGTGAAGGAGCAGCTGCAGAACCTGTGCAGCATCTACGCGCTCCACCTGCTCCACAAGCACCTGG
GCGACTTCCTGTCGACGGGGTGCGTCACAGCCAGGCAGGGCGCGCTGGCCAACGAGCTGCTCGGGAAGCTGTACGCGCAGGTGCGGCCTAACGCGGTGGC
GCTGGTGGACGCGTTCGACTACACGGACCACTACCTGGGGTCGGTGCTGGGGCGGTACGACGGGGACGTGTACCCGGCGCTGTACGAGGAGGCGTGGAAG
GACCCGCTGAACGAGACGGTGGTTCCCGACGGGTACCAGGAGCACCTCCGGCCGCTGCTCAAGCAGCAGCTCAAGCTCTCCAGGCTATGATACGCGTTGG
ACTGTGGATGTGAAGCAGTAATAATTATCACAAGGAAAGAGGCGATTGGTTATTGTTGAATTGGCAAGGCCGGCAAGAGGGACACACAGACAGACGCTGT
TGTTAGTAGAAATAAAAGGATCGTGCTCCCTCCTGGGTAATTAGTACGGTTGCTGTGGTTGTCATTTTGGTTAATGCATGTTTAGCCGGTGCCAGTATTA
TTGAGATACTTATCAGTAGCAAGTGTGTGGATGGATTCTTT
page-top