Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig742  (registered. 2012)
Contig Information
Length 772 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 3
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242075424|ref|XP_002447648.1|| hypothetical protein SORBIDRAFT_06g011300 [Sorghum bicolor]
Score 360
Evalue 9.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig742
AACCATCTGACCCGCAACCAAACCAAACAGACCAAATTTAGCTGCAGACAGCGGTAACAGAGCCATCAAAACAAATGGTATCCACCCAATGCATCTTAAC
TATCTGATTTGGGCAAAACAAAATAGGCAATGTGCGGGTGCACATGGAGTACATTGCAAAATTGAGGTGCGGTACAGTGTTAAGTTAAAATCTCACAGCA
GCTGCCACCCGGCACCTAATCTTCCTGCAACGCCTTCATCAAGTATAGCCTGTTGAAACTCTGGCCAGCAACCCCATTGATATGGTTGCAGTAACTCGAG
ATCTGATTGGTTACGAGATAACCCTCTAAGCGGGATGGCTCAGGAAGCGGCTTGAAGATAGGGTTGGATGGATCTTCTTCTGGCAACGGCTCCTCGCCAG
CAGCCTTTCTGGACATGTTCTCTTGCCTTCTCTTTTGAAGCCATGCCTGTTGCTGTGACTGTTGCCTTCCTAGGTTGCGATAGTAATATTGGAACTTGTT
TTGCTCTGATGAAAGACCATCCATGCACCCAATCATAAATTCTAGGTTCCTTTCCATAAAGGGCGCAGTCGACAATTTAAGACGGTCAAAGTCACACTGT
GAAACAGGTGACTCAGGTTCCAGCTCCTTCATGAAGGCACTGACAAGCGCCGAGTTGGACACTTTAATCGGTATCTCCTCGAAAATATCAACCCATGACA
ATTTCTTTTCCCTTAGCTTCTCTCCAGTTAAANNATTGTTGCGGTACAGATCCATAAAAGAGTCTGTGAGCT
page-top