Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20743  (registered. 2003)
Contig Information
Length 1989 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit hypothetical protein OsJ_002200 [Oryza sativa (japonica cultivar-group)]
Score 456
Evalue 4.90468e-43
Total Hit Count 167
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20743
CTCTTTGACTCTTCCACCAGATCTGGAGGCGCCCTCGCGTCAATAGCCCCTCTCCGCACTCGATGGCCTCAGTTCCAGCCGCCGACGTCGACCAGGGACC
GACGATGGACGGGACAGAAGTGGACGATAACCTCATGGGGGCTGGGAACTCAGACATGGCTATAAAGATTGTCACTGAACCTTCTAAACTACCAAATAGC
CTCCTCAAACCTTCACGTACCGATGCAATAGTAATTGGATTTGACTGTCAGGGTATTGATGGCATCAGTATCTTGCTGCTTGCGTTGCCCGATGCTGTCT
ACTTAGTTGATGCTATTAAGGGTGGACAAGAGTTAGTTCAAGCTTGCAAGATTGCACTTGAATCGATTGCCATCACCAAAGTAATTCATGACTGCAGGCG
TCACAGCAAGACACTTTTTGATCAATATGGCATCAGACTTCGTAATGTGATGGACACCCAGGTTTTATATTCTGTATTGCAAGAGAGGAAATGGGAAAAG
CCAGAACATGACCGCATATCTCTCTTTGCTATTCGTCGCTACCATGAAATGACATGTGCTGCAGAACAAAGGCTCAAAATGCTGCCTTGTCAGGAATGGG
CGAGAAGGCCCTTATCTAAAGTCATGATCGAAATGGCTAGGGATTACGTGTCCTTCCTTCCTGCTTTACATGCTATAATAATAAAGAACTTAAGCAAGTC
ATCTTTATGGCAAGTGGCAGTTCAAAGTGATGAACTTTCAAGACATTATTATTCGCCAATTTCTGTCATGTTTGGGCCTGGATCATGTCTTAATGATGAA
CCGGTAGAGGCATATACAAATCGGTGTGCTACTACATTGTGTTACACCATCGATACTGAGCTTGAAATTCTTGTTGCCACAGATGACGGAAGATTCCTAT
TGGCCGGATTTTTTAAATACCTAATTAGTATGCTGCTTAAAAGAAAGAGCTGGAAAGCCTGTTTTCAGTTGCAAAACCTTGTCATTCGAAATAAGGAATT
CATAATCTCGATTCCGCCTACTCACGAAGCCAGTTTGAAGAATGCATTCCTTGATCTGCAGAGAATGCTGAGCCTTCTCCTTCCTTATTTCTTAAGAAAT
AACAGATATGCAAATTACATCTCTAGCCTCATTACGGTCATTGATAAATATTCAATTGAAATTGATGATTCTGATTTGGTGAAATTTCTTTCGGAATTAC
TTGGTCACATGTCATTTAATTCACCAGTTGACAATTCAAGCCTACTTTTTCATCTGATCACCATATATAATAATATGCTGCCGGAAGCCGATAAGATTAT
TTTTGAGCATGCTGTGAACAGAGCCCAGTTTTTTGATGAATCTGGTCAACAAATTGATTGGAGAGAAATGGCATGGCGAAAGGCTTTATTGATTAGTGAT
AATGTTTCCACCACTCCAGTGAGAAAGGTTCATACTTTCTTTGCAGACTCGATGTTATGTCCTGTTTTTAACAGGCACTTTAAAGAGCATGTGGCTGAAT
CAGCATCTGCAATTCAAACACCTGAAGAATTGGACATCTTTGGACACTTCTATGGAAATTTTACGGCTCAAGCTGTGATGGCAATCTTTATGGCATTCAA
TCCTGGCGACAACAAGGAGATTGATAATCTTCGTGATAATCTTCGCAGATGTAGAATCTAGAATGTGAAAAATCCTGGCCAAGGCAGTATGTTTTGGGAA
GTTCAAGGTCAAGAAATCCTCTTAATAGGGATCATGACCCTTTTTCGATGGAAGAGCGAGTTGGTGATGCTGATGGTTTTTCTTCCCTAGATTCAATGGA
GGATGATTTTGGTTAAAGATATTTGGCTGAGGAAGCTGTTAGTTTTCAGACAGTGAAATAGTATTGCTATTTGTGGATAAGCTCGCCAGCTATAGCAATT
ATTGTTGCACTGATTTGCTATTTTTGGTGCTAAATTTGACAGTCTTATTTGCCCATCTTCGATTGAAGTATGTGCTGTGATCTGATGCA
page-top