Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20692  (registered. 2003)
Contig Information
Length 981 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit Os02g0710900 [Oryza sativa (japonica cultivar-group)] >gi|41052647|dbj|BAD07495.1| putative growth regulator [Oryza sativa Japonica Group] >gi|41052863|dbj|BAD07777.1| putative growth regulator [Oryza sativa Japonica Group] >gi|113537429|dbj|BAF09812.1| Os02g0710900 [Oryza sativa (japonica cultivar-group)]
Score 672
Evalue 1.67412e-68
Total Hit Count 372
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20692
TTTTTTTTTTGAAACCCCTACCAGGCATAAAATCTCTATAGTAGCTGTTATCAAAATATAAATGAGTTTCAGTACAACAATGCAGCTACAAAGTCTTCTC
AGTCCTGACAACTAAGCCTTTCGAGCCGCTATCTCGACAGCATATGCCCTAGAGACCACAATATTGCTATACAGCGATCAATATCAAATTCTTCTCGCTC
GTATAGCATCTAGCCTGCCGTGAATTCCTACACAAACCTCTCTGTCTTTTCGGCCGCCAAACAAAACTGTGGTGGTGACGAGCTATCTTCTCGGAGTATA
TTTTGAGTAGTATCTCTCAGGGGTGTTCAAAAGCCGATTCTAATAATCACAACTCGTCATGGGATTCTGGTTCCGAATCGTTATTCTTCTCAGGGGCATC
TGATTCCGACGGCTTCTCCGTGGATTCAGACTCGCTGGATGCAGATTCTGAAGAGTCCGTCTTCTCCTTGTTAGCTTCCTCCTTTGCGGGTTTCTTCTCA
ACCTTGGGTTTTGGTTTTGGGATCCTATTGACGCTAGAGACCTTATTTTGTAGGGCTAAAACTTTCTGGTAGACCTCTTCAGATGTGAAAGCAGGCGAGC
TGTGGACAGGGGTGCTCTTCTGTAGGGCTTCCTTCTCCTCCAACCAAGTTTTCAGTTTATCTGCTTCACTTACGACCTCATCTACTCTCTTTTTTGGAAG
CCATGGTTTGCTTGTATCCCAGTTCTTAACAATCTTTTGTAGCTCAGTAAGATACAATCGAGCACTTCCGCAAGCTGCTGGTCGGGCTTTTAACTCACTC
ATTCTGAAAAGAATTGGGTCGCCCATGGCCTTAAGCTGATCAAGGCGCTCTTGAAATTCGTTTGCTTGAGCCTCTTCACCATCCATATAGAGCCAATCCT
GCACCTCACTGAGTTTCGCTGTAAAAGATTCCCTCTCCTGTTCAGTTGAGACGGCCAACATATCTGTGCTTTCCTCCAACT
page-top