Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20677  (registered. 2003)
Contig Information
Length 850 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit UCW116, putative lipase [Hordeum vulgare subsp. vulgare]
Score 960
Evalue 5.33909e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20677
TTTTTTTTTTGGAATGGAACAAAACAATTATCAGATTATTACAGGTTCACAGCAACAGATGCACTACTATTCCACGACAGTTGCCGTCATTCTTTCCCCT
TCCTTCATCACCACACACGCACCCAGATCAGACCGGGAACCCGGCCTTAGCCAGTCCCCACAAACGTTTCCTTATAATTAACCCGACCGAACAAATAATA
ATAATAATAATAATAATATAATCGATTGATTGATTAATGATGGATCCATGGACGACGATGCATAAGCTGATTGATCGACCAGTGGGAGTGACTGGCTAGT
GGGTGATGCCTGGGTGGCAGAAGGCGCCGTTGAGCCAGCCGTCGGTGATCTGCTTGTAGGCGGCCTCGGTGAGGTGGATGCCGTCCCAGCTGAGGTGGGA
CGCCGGGCTGGCGCAGGCGGAGGCGCCGGACATGCCGCACCGCGCGCTGTTGGCGTAGTTGTACTTGCCTCCCCCCGACCCGCAGCACGCCTCAAACACC
GAGCTGAACCCGTATTTGCTGGGGCTCCGGACCATGTCGTAGACCCCGGCGTAGAAGTCGGCGTACATGATGCGCGCCGACTTGTACTTGGCCTGGAGGG
CGGACACCTTGGCCTGCAGCAGGCTGTTGTGGTACGTGGAGAGGTCGTTGAACTTCTTGAGGCAGCCGAGGGCGTCGTAGTCGGCGGCGCTGGAGGTGCC
GTAGATGGTGAGGTAGATGGGGAAGCAGCCGATGGGGAGCACCCCCGGCACCACCACGTCCACGGCCCCCATCGCGACCAGCTTCTCCACGCCGGCGCCG
ATGGTGTCCACGATCTGCGGCGCGTACGTGCTCGCCTGGTCCGTGTTGTA
page-top