Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20640  (registered. 2003)
Contig Information
Length 1818 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit RecName: Full=Eukaryotic initiation factor iso-4F subunit p82-34; Short=eIF-(iso)4F p82-34 >gi|452440|gb|AAA16209.1| initiation factor (iso)4f p82 subunit
Score 1028
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20640
AAAGAAAGGACCTTCAAACTTAGAACACTTGGAAATATTCGTCTGATTGGTGAGCTACTCAAGCAAAAGATGGTTCCTGAGAAGATCGTTCATCACATTG
TCAAGGAGCTACTGGGGTCTGATAAAAAGGCTTGCCCTGATGAGGAACACGTCGAAGCAATTTGTCAGTTCTTCAATACGATTGGTAAACAGCTTGATGA
GAACCCAAAGTCTCGCCGAATCAATGATACCTACTTCGTCCAGATTAGGGAGCTAGTAGCGAACCCTCAGTTGACCCCACGTTCCAAGTTCATGGTCCGG
GATTTGATTGATCTCCGTTCTAACAACTGGGTGCCTCGACGTGCTGAGATTAAGGCGAAGACAATCAGCGAGATCCACACAGAGGCTGAAAAGAACCTTG
GATTACGTCCAGGGGCCACAGCGAACATGAGGAATGGCCGTAATGCACCAGGTGGGCCTCTTTCGCCTGGAGGTTTTTCAGTGAACCGGCCAGGAACAGG
AGGTATGATGCCTGGGATGCCTGGATCTAGAAAAATGCCTGGGATGCCTGGGTTAGATAATGATAACTGGGAAGTTCAGCGTTCTAGATCAATGCCAAGA
GGCGATCCGCTTCGCAACAACCAGGGTCCGTTGATTAATAAGGTTTCATCTATTAACAAGCCATCACCCATCAACCCCAGGGCTTCTTCCTCAAGGCACT
GGAGCACTGATTGGCAAGAGTGCACTCTTGGGCACCGGTGGTCCACCATCCCGCCCTTCCAGCCTTACGGCTAGCCCCACTCCTTTACCAGCTCAAACTA
CAGCATCACCAAAACCATCAAGTGCAACTCCAGCTTCTGTACCTATTCCTGACAAAGCAGCCAGTTCTGCCAAGGTGATCCCTGCAGGGCTTCAGAAGAA
GACAGCATCTCTTCTTGAGGAGTATTTTGGTATTCGTATTTTGGATGAAGCACAACAATGTATTGAGGAGCTGCAGAGTCCTGATTACCACCCTGAGATT
GTTAAAGAAGCTATCAATCTTGCTCTGGATAAAGGTGCCAGTTTTGTTGACCCTCTTGTTAAGCTTCTGGAGCATCTGTACACCAAGAAAACTTTCAAGA
CCGAAGATCTGGAAAATGGTTGCTTGTTATATGGGTCGCTGTTGGAATATATTGGTATTGACCTTCCTAAAGCTCCAACGCAATTTGGTGAAGTGGTTGC
TCGTTTGATTCTGTCGTGTGGCCTGAGATTTGAAGCCGCAGAGGGGATTCTAAAGGCAATGGAGGATACCTTCTTCCGCAAAGCAATATTCACCTCCGTG
ACGAAAACCCTAGGAGCAGACCCAGCAGGCCAGGCCATATTGAGCTCACATGCTGCCGTAGTCGACGCGTGCAACAGCCTCTCGATATAACAGCTCTTGG
CAGCTCAACTTCTCAGGTGCTGTGTCTAGTGAAAAACAGCGTATGGTGTATTCTCTATAGCTTAGGTGTTTCACCGCAGAGGAACTGGGATGTGAGCAAC
AGCCAGTTTTGAGCTGTATATTTTTGCGAGGTCACATGAGTGTTGATTATTGTTTCGAGGAAAGGAAGAAGCCATGGATTTTGGTCTCTCGGCGACGGCG
GCCTAACTCTCGCTGGAGCCTGGGAATGAACAAGGCTTTTTTGTTTTCAAAATGGGATGTTTTTGTGTCTCCTCCAATGTTATTATTTCTTTTCAGTTCT
TACACAATTTGTAACAATGTACTGTGGTTTTGGAGTATTCTGTCGGTTACAATATATCGTGTCAGCATTGTAGGAGTCGAAAACTGAATCTAAGATTATT
TTTGGCTTAAAAAAAAAA
page-top