Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20638  (registered. 2003)
Contig Information
Length 690 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 4
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit ZIM motif-containing protein [Triticum aestivum]
Score 578
Evalue 7.05614e-58
Total Hit Count 182
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20638
TTTTTTTTTTGAAAATAGAACGGTTATCATAATTTGGATTGATCATGAACGGGGCACAGAAGTACAAGACTTGGTTTTGAAGACTTGGCCTCATACAAAT
GCATTTCTAAATGCTGTGGTACACCATACACAGCATGTGGAAACACAAAACAACAAATGTAAGGGGGTCATAATACTCATAATACGCTCCAGAAGAACGT
AGACTGCTACTTGTACTCTTCATTCATGCTAACCTGTCACGGCGCTTCTCCAGGAAGCGCTGAAGGGAGTGTCTCCTGGCGATGGGAAGATCAGCCTGAA
GCTTGCAAATCGAGCCAGGATCCGCGACAGCCTGAGGTTGTCCATTTGCTACAGAAGTGCTCTGGAGTGAGAGCGACCGCGTAAGCATGGCTTGGATAGC
ATTGGTCGCAGACATCGCTGGAGGCTTAACAGCAGTGGTGCCATTGCTTTTTGAGGCCGCAGCTGCTGCTGCTGCAATGAGCATGATTGCTTGAGCCTTC
TCTGGTGGCACTGAGTCATACACACATACTGACCCACCATAAAAAATGGTAAGCTGTCCCGGATTTGCTGGAGGGCTCGACATTCGCAACATTCCAGACC
TGCCGTTGGCGAGCGGGGGTCGGCCGGTGAGCCCTGGCTGCTGGGTCTCCTGCTCCTTGTGCTCCTGCTCCTGCTCCTGCTCCTTCCTCT
page-top