Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20631  (registered. 2003)
Contig Information
Length 1278 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_VABA Shoot with ABA treatment 3
Homology (BLAST) Top Hit membrane protein [Zea mays]
Score 1146
Evalue 2.69726e-123
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20631
GAGAGGGAGGAAATTTGGAGTCGAGGGGGCAGGAGAAGGGGAGAGCAGAGAAGCTTGGAGGGCGGAGCGCGTCGGCGATGGACGGCGAGTGGTGGAGGAA
GAAGTGGGTGGCGTGGGCGGCGGCGGCGGCCATCTTCGTGGTGCTCATGCTCGTCACGCCCGCCATCCCGCAGGACGAGGACTACCACGACTTCGCCGAC
CAGCGCGACCTCTTCCTAGGGATCCCTAACACATTGAATGTGCTCTCAAATATCCCTTTCCTCTTTGTTGGTCTCGCTGGGCTCATCCTGTGCCACTACA
AAAACTACTTCAGGCTATGCTCACAGGGGGAGCTCTGGAGTTGGACACTCTTCTATGCTGGTGTCACTACTGTCGGTGTTGGTTCATCCTACTACCATCT
CTACCCAAACGATGCCACCTTAGTTTGGGACAGATTGCCTATGACGATTGCTTTCACGTCTATTGTGGCCATTTTCATCATTGAAAGGGTTGATGATAGA
GCAGGAACAAAGTCCCTTGCACCCCTTGTTATTGCTGGTGCACTGAGCATCCTGTACTGGAGTTTCTTTGATGATCTTCGGCCATATGCAATAATCCAGT
TCGTTCCATGCATTGTAATACCTGTGATGGCTATAGTTATTCCACCAATGTATACACATTCAAGCTACTGGTTGTGGGCAGCAGGATTTTACCTTCTTGC
CAAAGTGGAAGAGGCTGCGGACAAACCTATATATAGGTGGACACATGACATTGTTAGCGGACACACTCTTAAACATCTATGTGCTGCGATGGTACCTGTT
TTCTTGACTCTCATGTTGGCAAAGAGGACAATTGAACCTGATAGGGTAAGCTTACTCCAGATGTGGAAGATCAGTTGGAGAGAACGTGGTTCCCAAGATA
GCAACACTGTAGACGTCAAATATGATTATGCTGCAGTTTCAACTACGTCTGAACAACAGTAGATATGTGTTCTTCATATGTACTCTACTCCCGAAGTGTA
AAAATAGCATCGATCTGAATATCAGGAGCCCCAGCTTGCACGGTTGTGTATCATTGCCTGCTAATCAACGTTCGTATGTTGTTGTTCCTGATCAAAACTT
CCTGATCATATCTTGTACAGGAAGGAAAAATATATATTAGTTCCCTCATCAACTCTTTGTGCTCTAGTTTTTGGGAACCTCAAACAGCCTATACCTCCTC
CTGCACCTGGAAAGACCGTAGCCTATGTAACTGGACGGGGATCTATTGAGACTGCACCTGCTTCAGTTAAAAAAAAAA
page-top