Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20595  (registered. 2003)
Contig Information
Length 902 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 8
Homology (BLAST) Top Hit hypothetical protein LOC100192043 [Zea mays] >gi|194690490|gb|ACF79329.1| unknown [Zea mays]
Score 868
Evalue 2.738e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20595
TTTTTTTTTTGTCACGACAACCACACAAGTTTTTAAACTGGTAATATCACATACTTGCATATTATGTCGCCATTATTCGAGAAAAAGAAACAGAAACGTG
GCCATTTTAGTAATTCCAGCTAACTCCACACTTGGCTATTTTCTCCTTGCATCAGCTGCTCACCAGGCCGCCATGCCGCTTTATTGAGTGCTTGCAGCCG
CGGCGGAAAGCCGGGCCTGTATTCCCCCGGCGTACTCAACCACCCTGTCGACGTCCTGGAAGACCGCCTTGGCCGCGTCGAGCTCGCTAATGCGCTCCAT
CCATGCCGCCAGCAGCGGGGCCCTGCCGGCGTCGATTAACTTGTCGGCGGAGAGCCTCTCGGTGGCGCGCACCCACGGCACCATGCTACCGAGCAGGACG
TCGACGTACCCGACACAGTCGCCGCCGAAGAAGCCCTTCCCCTTGGAGCACTCCCTCAGGCCTTCCTCCAGATGACCCACGGCCGCCACCGTCTGCCTCG
TCCACTCCGCCCTCTCCTCGTCGGTCGTCACCCTGAACACCTTCCCCCACGGCGCCAGCAGCTTGTCTTCGACGTAGGCGGCCCAGAAGCGCGCGACGGC
GCGCTCGTAGGGGTCGGCGGGGAGGAGGGACGGGCCGACGCCGGCGAAGGCCTCGTCGATGTACTGCAGGATGACCTGGGACTCGCAGACGGGCTTGCCG
TTGTGGATGAGCACCGGGACCGTCTTGCGCACCGGGTTGGAGCGGAGGAAGAGCTCGCTCTTGTTGGCGAGGTCCTCCTCGACGTACTCGTAGCTCACGC
CCTTGAGGCGGAGCGCGAGCTGCACCCTGACCACGTACGGGCTCGCCCACATGCCCAGCAGCTTCAGCTCGTCTCCTGTGTCTGCCATTTTCTCCCGTGG
GG
page-top