Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7401  (registered. 2012)
Contig Information
Length 937 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 8
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 7
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_CA 2
WH_SP 2
WH_XB Root 3
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064696|ref|XP_002453637.1|| hypothetical protein SORBIDRAFT_04g009660 [Sorghum bicolor]
Score 315
Evalue 5.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7401
CTCCAGTCCAGTATCCGTCGTTCCCCCTAGCCATCGTCCCGCGCCCCGTCCATGGCCACCGCCACGCTCCCTCTCCGCCTCCTCCCCTCGAGAACCCCAC
TCCTCCACACCGCCGCCTTCCTCCCCGCAAGCGCCTCTCTCTCCGTCACCGCGTCCGTGCCCCGCCACTGGCGCATCTTCGCGGCCGCCGAGGAGGCGCC
CGCTCCGGTGGAAGCCGAGGCGGAGGAGGTGGTAGAGGATGCCGCGGTTCCGGAGCCTGTTGAGGTGCAGCTGGCTGCTGCTGGCGCGGGGAAGGACGCC
GACATCTTCGCCGTTGTCATGATTGGGTCCAGACAATACATTGTGATGCCAGGTCGGTACATATACACACAGAGGCTGAAAGACGCCAATGTCAATGATC
AGATCATTTTGAACAAGGTACTACTGGTGTCAACTAGAGACAAAGCTTATATTGGCATGCCAGTGGTGACCAATGCTGCTGTTCATGCAATTGTTGAAGA
ACAGGGACTGGACGATAAAGTGATTGTTTTCAAGTTCAAGAAGAAGAAGAAGTACCAGAGGAAAGCTGGTCACAGACAGCCAAATACGAGGTTAAGAATT
ACCGGCATAAGTGGATATGAGGAATTCCCTGCTGATCCAATACTTCAAGTTCCAGCTTAAGTGTAATTGTAAGTTGTTTAGTTACAAATGCTTGGTAGTA
CATTAGAGTGCTAGAGCATTTTCCCCACTCTTCCCCAAGTGAGGCTCTTCCCCAAGTTAATGTACTCGAAATGCTGCCATTCGTTGAGTGGCTGGTTCCA
TCCTTTTGTTCATTCCACCAGCTCTTATGTTCCTTTCAAATCCAATTGTATTATCTTGACTGTGCAGAAAGACAGGGGAAAGCATTTAATTACAATGTGG
ACATGTTAGCTTTGGATTGTGCAATTTTCAGAGTTGT
page-top