Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7398  (registered. 2012)
Contig Information
Length 1074 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242033247|ref|XP_002464018.1|| hypothetical protein SORBIDRAFT_01g010630 [Sorghum bicolor]
Score 528
Evalue 3.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7398
AGTTCCGTACCCATCCCCTCCACTGGTCAATCCCCATCCCCTGTTCCGTTCATACATCTACCTCCTCCGCCGCCGCCATGCCGCCGGCCGGCAGCCTCAC
CGCCGAGCAGCTCAGCTTCTTCGAGAAGAACGGCTACCTGGTGCTGGAGTCGTTCTCGAGCGCGGAGGAGGTTCAGGCTATGCGGGGCCGCATGGCCGAG
CTCGTCCACGGCTTCGACGGCGCTGACTCCAGTGTCTTCTCCACTAAGGATCATCGGCAGTTGAAGGATGACTACTTCTTTAAGAGTGCGGAGAATATAT
CTTTCTTCTTCGAGGAAAAGGCATTTGGAGATGATGGATGCTTGAGACAGCCAAAGGAACTTTCAATCAATAAAGTTGGACATGCACTACATGAACATGA
CCCTGTGTTCAAAAAGTTTGCTTTCTCGGAGAGTATTTCTAGCCTGTTCTCTTCTTTAGGGTACAAGAGACCTGCAGTTATTCAATCTATGTACATCTTT
AAGCAACCGGGCATTGGTGGCGAGGTGGTGCCACACCAGGATAATACATTCCTTTATACAGAGCCCCTATCATGCACAGGATTGTGGCTAGCACTTGAAG
ATGCAACAATTACAAACGGTTGCCTATGGGCAATTCCCGGATCACATAAAAATGGTCTAAAAAGGCGAATGATCAGAGATGAAAATGGTACTCATTTTGA
TCGCCCCTCCCCGCTTTATGACCAGAAAGAGTTTGTACCACTGGAAATGAAATCAGGTGACTTTGTTGTTATTCACGGCGATCTTGTACATCAGAGCTTT
GAGAACCTTTCTCCAGTGTCAAGACATGCACTGAGCTTACATGTAGTTGACATGGAAGGATGTAAATGGTCCAAGGACAACTGGATACAGAGGAAAACTG
CGCCTGAACCGCTCTATGTGTCTTAGTTCAGCCAGTTACTAATAAACCTGATATCTTCAGCAAGCAGTTTCAGTTGCTTATCATCGGTGCAAATTTGGGA
ACGCCGCGGAGCAATGCTGGTTTCTTTGTTGTCTTTCACATGTGTACACTGTAAATACTGAATACTAGCTGTTG
page-top