Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20539  (registered. 2003)
Contig Information
Length 2108 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os07g0636000 [Oryza sativa (japonica cultivar-group)] >gi|23237811|dbj|BAC16386.1| putative centromere/microtubule binding protein [Oryza sativa Japonica Group] >gi|113611927|dbj|BAF22305.1| Os07g0636000 [Oryza sativa (japonica cultivar-group)] >gi|125559298|gb|EAZ04834.1| hypothetical protein OsI_27012 [Oryza sativa Indica Group] >gi|125601221|gb|EAZ40797.1| hypothetical protein OsJ_024280 [Oryza sativa (japonica cultivar-group)] >gi|215734843|dbj|BAG95565.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2010
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20539
TTTTTTTTTTGCATCAACTGATAACAGATAAAGCAAACAAGCTTCATTGTCCAAGAAATTTAATGGGAAATCTCTCTAATTACCAGCATTTCAGGTGAAT
GGCAGCAACCTAACGATAGTACATTAGGCCTACGAAACCATAGACGGTTGCAAGGGGTACAGGGCAAATAAAACAGGTAGCTCAAACTCGCCCACAATTG
CAACCAAATAACATGACCAGCCGAAGTAAACTACTAGCTCTACCTATTGTGCCGCCTCCTCTGCGTCTTTCTTCTTCTTTTTCTTCTCCTTTTTCTTCTC
ACTCTTCTCAACTTCACTCTCTGTAGCGACATCATCACCACCTTCCTTGCTCTTCTTCTTCTTGTCCTTTTTCTTCTCGCTCTTCTCAACTTCCGCACTC
TCTGGAGCAACATCATCACCGCCTTCCTTGCTCTTCTTCTTCTTTTTCTTCTCGCTGGCACCCTTCTCCTCATCAGACAAACTGCTCTTCTCCTCCTTCA
CTGCCTCCGAAACAGCTGATCCTGGTTCTCCCTTATCTTTCTTTTTCTTCTTCTTCTTCTCACTCTTCTCCCCTTCCACTGCCTCAGTGACCTCCTCAAC
CTTCATCTTCTTTGCAGGTGTAGAAGCAGTTACATCATCCTCATCAGTCTTCCTCTTTTTCTTCTCCTTGACCTCCTCACTTGGCACCACATCCTGTTGT
TCCACCTTCACCTTCTCGGGCTCAGGAGCAGCTGCAAGGCTAGCAATCATCGCATCACCACCAGTAGGAAGCACCACATTTCGAAGCCACTCAGCTGGGG
TCTTCTCAGTTGGCTTCCCATGCTTATCAAGGAGGCCCTCGGCGATCATCTTCTTCTTCTTAAGTGCCACCGGACCAAGTCCCCACTTCCTTGGGTATGT
GTCCCTGTCCATCACCACCCTCTTGATCTTCGCTACAGCACCATGGTCGCAAGTTGCCATAACAGCAGTAGGCATCTCAGCGATACCAATGGCAATCGCC
TCCCCCTTGGTAGTCATGAGAACAACCTCTTCCCCAACATCAATGTCATTCTCAAACCGGAGCAACCCAGGAATCATAAGCTTGGCACCATAGCAGATAG
CATTAACAGCAGAGTCCTTCACAACAAGCCTCTTGTAGCTAGTAAGAATTACCTCAAGCGGCATAACCACACGCCTTATGTAAGACTCATCCTTGTGGTT
GTCAAGCGCCCACATGGCATCCATCACATCGTGCATGGTGACCATGTTGTCCTGCTCTCCGAGGATACCTGACCGGACACGGCGAAGCTCCTGCATATGT
GCACCGACGCCAAGGAGCAGCCCAAGGTGCACACAGAGCGTCCGGACATAGGTTCCAGCCTCACAAGAGATCCAGAACACAGCAAGGTGGCGCTCGGCGT
CATGCTCCAGCAGCTTGCTCTCATAAATGGTCCGCACCCTGAGCTGGCGCTTGACCGCCGAGATGAGCGGAGGCCGCTGGAACACAGCCCCGGTAAGGGA
CTCCAGCGCGCGGGCCACGCGGGCCGTGTCTGGAACGGCGGCGTGGAAGCGGGCGATGCACACATACTCCTTACCTGCGCCCTGCTGCGACTTGACGAGG
CGTGTGGCGCGGTCGACGCAGACGATGAGGTTGCCGGTGACCTTGGGATCGAGCGTGCCGCTGTGGCCGGTCTTCTCGACGCGGAGGAGGCGCTTGATCC
ACGCCACCACCTCGTGGGAGGAGGGGTTGGACGGCTTGTCGAGGTTGATGACGCCGTAGCGGAGGTACTCGGCGAGGGGGCGCTTGAGGGGCGAGTGGCC
GGAGGGGAGCGGGGTGTAGTGGCCGGTGCGGACGTTGAGGCGGTCGTAGTTCTTGAGGAGGAGCGGCCAGGTGGAGGTGTCGAGGGACGGAACCAGGGCC
TGGGGCTTGATCATATAGCCATCAGTCTTCGCCTCGGCGTCCGCCAGCGACGTGGTATCGGCGGCGGCGGCGGCGGGGTCGGGGTCGGCGGAGGCGTCCT
TGGATTTGCTCTTCTTTTTCTTGGATTTGGTGTGCTCAGAGGCAGGGGACGCGACGGCCGGCGGTCGTGGATCGACATGGCGGCGGGTGGGGTGGGGGTA
GGGATTAG
page-top