Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20526  (registered. 2003)
Contig Information
Length 1097 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_38769 [Oryza sativa Indica Group]
Score 1052
Evalue 1.7258e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20526
GCTTCATTCTTCTTCTCCCAAACAGACTGGAGTTCATCAAGGATCTCGTCCTGAAACTGGAGCCCACAAGCACTCAAAGGAAGAAGAGCAAGAAGACGGG
CTCCCAGCCGATACAAGGTAGGAGCGAACAACGTTAGGGTACTGTCGTTATATCCTGAGTTGATATGGTGACAGTGAGAGAAGAGACACGCAAAGGGCCA
TGGACAGAGCAGGAGGACATGCAACTGGTATGCACTGTCCGTTTGTTCGGTGAACGCCGTTGGGATTTCATTGCCAAAGTATCAGGCCTCAACCGCACAG
GAAAGAGCTGTCGCCTCCGGTGGGTTAACTACCTCCACCCTGGCCTAAAGCGTGGGCGCATGACTCCCCATGAAGAACGCCTCATCCTCGAGCTCCATGC
TCGGTGGGGAAACAGGTGGTCCAGGATAGCACGGAAGCTGCCAGGGCGTACCGACAATGAGATCAAGAACTACTGGAGAACACATATGAGGAAGAAAGCA
CAGGAGAGGAAGAGGAACATGTCACCCTCATCATCTTCATCCTCAGTGACATACCAATCCATTCAGCCACAGACGCCATCGATCATGGGAATTGGCGAGC
AGGAGCTTCATGGTGGCAGTAGCTGCATCACAAGCATATTGAAGGGCACGCCTGCTGACATGGATGGATACCTCATGGATCAGATATGGATGGAGATTGA
GGCACCCTCTGGGGTCAACTTTCATGACGGGAAGGATAATTCATACAGCAGCCCCTCTGGCCCTCTGCTACCATCACCGATGTGGGATTACTACAGCCCT
GAGGCAGGCTGGAAGATGGATGAGATAAAGATGGCCCCACAAGTTAGCTACAGTAAAGGAATTGGCCCCAGTTATTGAAGCCATATATATTGTATCAGAT
TACTAAGTTACTTGCAACCTAGCAGAAGTGAAATGCTTTTGTTGAAAGAACCATTAGCATGGATCTAAAAAGTATTTATATCTATCTAGCATTCCAAGTG
GGCTCATGTTTTATGTATCTACTATGTAGCATCTAGTGTGCAAGACATGTAATGCAAGGACACTTCCACTCTGTATTCACAATAATCAGCTATCTCC
page-top