Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7395  (registered. 2012)
Contig Information
Length 1156 bp
Clones alternative view 157 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 21
Wh_SHC Shoot grown with cold treatment 11
Wh_SHDr Shoot grown with dessication 22
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 7
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 12
WH_XF Seedling, infected with leaf rust 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657845|gb|AAB18202.1|| cold acclimation protein WCOR410c [Triticum aestivum]
Score 515
Evalue 4.00E-144
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7395
GCCAAGCAAAAGCCACAAGCCAAGAACCAATACTTGATCTGTTGTTTTCTTTAGCTCCCGGAAGACCTTTTAGCTGCACCGATCGATCTCGATCATGGAG
GATGAGAGGAGCACCCAGTCATACCAGGGAGGTGAGGCCGCCGAGCAGGTGGAGGTGACAGACAGGGGCCTCCTCGGCAACCTCCTCGGCAAGAAGAAGG
CGGAGGAGGACAAGGAGAAGCAGGAGGAGCTGGTCACCGGCATGGAGAAGGTCTCCGTGGAAGAGCCCGAGGTTAAGAAGGAGGAGCACGAGGATGGCGA
GAAGAAGGAGACCCTCTTCTCCAAGCTGCACCGATCCAGCTCCAGCTCCAGCTCGTCTAGTGACGAGGAAGAGGAGGAGGTGATCGATGACAACGGTGAG
GTGATCAAGAGGAAGAAGAAGAAGGGTCTCAAGGAGAAGCTCAAGGAGAAGCTGCCCGGCCACAAGGACACCGAGGGTGAGCACGTGACGGGCCTACCCG
CACCGGCGGCCCCCGCGTCTGTGCAGACCCACCATGACACCGACGTCGTCGTCGAAAAGATCGACGGTGACGTGAAGACAGAGGCGGCACCGGCAGTGCC
CGAGGAGGAGAAGAAAGGCTTCTTGGAAAAGATCAAGGAGAAGCTGCCCGGCGGCCACAAGAAACCGGAGGACGCTGCTCCGGTGCCCGTCACGCACGCT
GCTCCAGCACCAGTGCACGCGCCGGCGCCAGCCGCCGAGGAGGTGAGCAGCCCTGACGCGAAGGAGAAGAAGGGCCTACTGGGCAAGATCATGGACAAGC
TGCCTGGTTACCACAAGACAGGGGAGGAGGACAAGGCCGCCGCCGCTGCAGGCGAGCACAAGCCCAGCGCTTGATCGCCGCCGTGCCCGAGACTCGTGAC
CGGACCTCGATTGAATTGTTGGCGTGTGTTGTGTTTGCTTTACGTTAAGTTGGTGTCAAGGTGGGAGGGGTTGATCGTCTTTGAAGGTTCGGTCCGTGAA
GCCCGTTCAGTGACGGATGCTTGTGTTTCAGTTTGGTTCAGAGTCAGGTCCTGGATGTTGTTAAGTTTGTTTACTTATTATGGGCGCTTGTGTATTGGTT
ATTTGCTGGGCATTATGCCTTGATATTAAAGATTTCCGCCCAGTACAAAAAAAAAA
page-top