Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20497  (registered. 2003)
Contig Information
Length 1464 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Os10g0456200 [Oryza sativa (japonica cultivar-group)] >gi|31432454|gb|AAP54084.1| ubiquitin family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639362|dbj|BAF26667.1| Os10g0456200 [Oryza sativa (japonica cultivar-group)]
Score 1440
Evalue 2.63791e-157
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20497
TGGAGAGCTCGCCGCCCACAATCACCGTCCAGGTGAAGTTCGCCGGCCGAACCATTCCGGTGGAAGTCCCGACATCCGCCTCCACCGCGGAGCTGAAGCT
CCTCCTCCAGCCGCTAACCAACGTTCTCCCCCGCGGCCAGAAACTCATCTGCAAAGGAAAAGTTCTTGCCGACGCCGCGAGTCTGAGCTCGATGCAGGTG
GGGGACGGATCCAAGGTCATGCTCATCGCTTCGCAGGGTCTTCATCAGGGGGAAGGCCCCATCACTAAGAATAGCAGTGGTCTTGCACCAAGTGCAAAAA
GAACCTCAAATGTTAAGGATAATCAAACACTAAAACCGGAGATTATCAGCAAAAGCCGAGCGGAGCGTTGGAAAATAACGGGTGTCATTGCTTTATCTGG
TTCCAGCTTGAAGGCAGTGCCTGAGGAAGTCTGGGACTGTGGCTCCTCCATACGAGTACTAGATGTCTGTAACAACTCAATTGAAGCAATTCCACAGAAA
ATTGCTGCCCTTAAATCATTAAATAAATTGTTGCTAACCGCCAATGACATATCTGATGGGGGCATCAGCTGGGAAGGTCTATCATGTGTTGATACATTAA
CAGTTTTATCTTTAAGCCAAAATCGATTGGTCACTTTACCTCCGAGTTTGGGCACATTGACTTTTCTACGTGAACTTTGCATTGCAAATAACATGCTTGG
CAGCCTACCTGTTGAAATAGGTTTGCTGAAGCAGCTAGAGATTCTTATAGCAAATAACAATAGGATAACTTCGCTGCCTTCCTCTATAGGCGACTGTGAA
TCTCTCTTTGAGGTGGACTTATCATCAAATCTTTTAGCCGAACTACCAAAGGCTTGCGGAAACCTTCACAATCTGAAGACTCTGCATCTAAGGAACAATG
GTCTTAATTCCCTACCGCCGACTTTATTCAAGAAGTGCTGGCGGCTTACTACACTTGATCTCCATGGCACTGGAATCACAAATGACATTCTTCGACAGAT
GGAGGGCTGGGAGGAGTTTGATGAACGTAGGCGGCAGAAGTATCAAAAGCAGCTGGATTTTCGTGTAGGATCATCAGGTGTTTTCGACGAGGGTGCGGAT
GATGATAACCGGCATGCATAAGTGTCTTTCTTATTACAGACAGGGTTTTGCGCTTCCAATATTGACCCAGAATTATTCTATAATTGAACTTGAACAGACA
TGGAGCTGATATTATTCCTCACATTTGGGTTGTGTATTTGTTTATTCCTCTCATTTCATTACATTTTAGTGCCAAGTGATGAAAAGTGGTGGCTACCTGT
TAAACATTATCAGAGCATTTGCATCCCCAGCATTCATAACTTATCAAGAACTTTCAAGATTTCTTTAGAAACACTAGAAGATTGCCTATGCGTTGCAACC
GTGATTGGAATTTTTCTAGTACTTTAATTATCTGCCCATATTAACCTGATTGTGTAAAAAATAT
page-top