Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20447  (registered. 2003)
Contig Information
Length 1020 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit Os03g0726400 [Oryza sativa (japonica cultivar-group)] >gi|41469273|gb|AAS07155.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|50428733|gb|AAT77084.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108710851|gb|ABF98646.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113549606|dbj|BAF13049.1| Os03g0726400 [Oryza sativa (japonica cultivar-group)] >gi|125587776|gb|EAZ28440.1| hypothetical protein OsJ_011923 [Oryza sativa (japonica cultivar-group)] >gi|215697077|dbj|BAG91071.1| unnamed protein product [Oryza sativa Japonica Group]
Score 525
Evalue 1.99587e-51
Total Hit Count 33
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20447
GCCATTCCCCCAATCGCCGTGTGCGCCAGCCCCAACCCCAACCCAAATCCACTCGCCTCACCGCCACCGTCGCGCCTCATTTGTTTATCAATCACCAGCT
CCCCTCCCCTCTCCCCCGTTCTTCCAAAGAAACAATCCGCGTTTAGATCCGTCCGCTCAGGCGCTAGTGAGGGGAGAGGAGGATTTAGGTGAGCAAGCAT
CTTGATTTTGACCAGTCCCAGCTCGACCTGCCTGCGCGTTTCTCCTTAAATCTCCTGCGGTGGAGGGAGGAGGGGCCGTGGCCGGACCAAGAAGGCAAGA
ACAGCTGCTGCTCCGGACATCTTGGCTGCCGGTGTCCCAAGGAAGGCTTCAGGGGTTGAGATAGCAGGTTGCTCTGTTGCCTCGATAGACTAATTAATAA
TGCTGAGGCAGAGCTCTAGTAGGAACCACAGATCGAAAGGTCTGAAGCTAAAGAAAGCTCTTCAGATAAGTCTTTTGGTTCTTGTGTCTGTTTGGTTGCT
CTACCAAGTAAAGCATTCGTACGAGAAGAAGACGGCATATAATGAAAATGATGCCACCAGTCACGAAGCCGGTGATGAGCATAAAGATGGTCAGAGCCAG
GTGGGCGTCATAAAATTGGGCAGGAAAGACCTGCCAGCAAAGGAGGCCGACTCGTCAACACTGGATGAACGGGTCGAGGACGAAGAGAATGAGGAGATGG
AGCAAGTAATGAAGCGTGATGAGCATGATGATGACCCCATTGATGAGCCAGACCTGGACAAGGATGAGGATCTTCCTGAGCCTGGGGAGCACTCGGCTAA
CAAGGATGAAGGGTCAGATGGCAGGGCTGTGTTTGAGGACGAAGAGCGTAAAGAGCGCTCTCAGGAGGATCAAGAGAAGAGTTTCCATGGTGATGATGTC
TCTAGCGCTGTAACACATGACCCTCCGTCATCGCAGCAAGATGTGCTGACCCATCATGCCCAAGAGAAGATCTTGTTCGTGGATGATGCTTCAACTGCAG
TTCCTCATGAAAACCAGGAA
page-top