Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20417  (registered. 2003)
Contig Information
Length 798 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 4
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194699868|gb|ACF84018.1| unknown [Zea mays] >gi|194706942|gb|ACF87555.1| unknown [Zea mays] >gi|195615212|gb|ACG29436.1| DNA-directed RNA polymerase II subunit J [Zea mays] >gi|195628620|gb|ACG36140.1| DNA-directed RNA polymerase II subunit J [Zea mays] >gi|195656859|gb|ACG47897.1| DNA-directed RNA polymerase II subunit J [Zea mays]
Score 577
Evalue 1.23572e-57
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20417
CCCGCTAGTACTACTCTCTAACCTTACCCAGACCGCCGCAGGTCTTCATCGTCTTCCTCGGAACGCCGCCGCCGAAGTGCGCCTCGAGTAATTTCAGAGG
AAGGAGGAGCCAAGTGTTGATCGGAGATGAATGCCCCTGACCGCTATGAGCGCTTCGTCGTGCCTGAGGGCACGAAGAAGGTATCATTTGAGAAGGATAC
AAAGATCATGAATGCTGCATCTTTCACTATTGAACGTGAGGACCACACCATCGGGAACATCCTCCGCATGCAGCTGCACAGGGACCCAAATGTTCACTTT
GCTGGCTATAAGCTCCCTCACCCCCTTCAGTACAAGATCATTGTTAGGATCCATACTGCAAGCCAATCCTCCCCAACTCAGGCATATACCCAGGCAATCA
ATGATCTAGACAAGGAGCTTGAGAACCTGAAGCAAGCTTTTGAGGATGAGAAGACCCGATTCGAGGAAAGGATGAAGCAGGGCTACTAGGCCAAGGGTGT
TCTGGATGCTGACGTGAAACCTTCCTTGCTAGTAATTATATCTGATGTCTGAACTGCGGTAGAAAAAAAATTACTCAAGGATTGTCGATGATCCTCTGAA
CTCGTAGAACCTCTTCATGTGCGGATTGCGTATGATTGCACGGTTGTTAAACATGTGTTGGCACTTGATAAGCCTGCTAGTTGAATTGCTCGCCTTTGAC
AGGTTCCGTAGAAGGCACGGACCAGACCTTGGATCCAAAAAAAAAAAACCNNAAAAAAAAAAAAAAAANCCCNAAANCCCNNAAAACCNNNNAAAAAA
page-top