Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20383  (registered. 2003)
Contig Information
Length 582 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 4
Homology (BLAST) Top Hit zinc-binding phosphatase [Leishmania infantum JPCM5] >gi|134069379|emb|CAM67531.1| zinc-binding phosphatase, putative [Leishmania infantum]
Score 78
Evalue 4.4483
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20383
GAGGAGGAGGCGGTGTTCACCGTGAAGGCCAAGGCGGAGGAGGAGGAGGAGGAGGAGGAGGATGACTGCGACTCGGACGAAGAGGAGGAGTTCATGGTCA
GGCTCATCGCAGACTACAACGCCCATGCCGACAAGCTCAGGGCTGACCATCCAGGGATGAAGTACAAGGACTACAGCACTGAGGAATACGCCTACATGCG
CCTCCAGCCGGAGGAGGTGGAGGACGATGACTGCAACAAGATCGAGAAGCTCAGGGCTGAATATGCCTACTTGTTCTGCAAGCTGGAGGAGGAGGGTTCC
CATGGTGTTGATGGGCTTGTTCGGGCGTGAGATTGTTCCTCTTGTAATTTGACTGACTGGGATGAAGAGGTTTACCAATGCTATCTATCTACACTAGTAG
TTGATTGATCCGGAGGATTAGTCATCAACCTATCTGTGTGTGTGGTCTTAGTATTATAACTTTAGAGGCGCCCTTGAACCAATGGCAATGGCATGTATCT
ACTATTAGCATTATCTCATCTTAACTCTGCTATTCCTCAGTTGTCTGTGATGTTTGATTTTATCTGAGCTTCAAAAAAAAAA
page-top