Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20366  (registered. 2003)
Contig Information
Length 1205 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_10012 [Oryza sativa Indica Group]
Score 1624
Evalue 9.32133e-179
Total Hit Count 142
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20366
CTGCTCTTCGTCTGGCCTGACGAGAATGGATGGGACAAGGCCAAGGCCACCAAGCCTCCAATGCTGCCGAAGGAGTTCGATGACCCGGCCTTCTCCACCG
TGACGATCCAGAGGGACCTCTTCTATGGGTATGACACGTTGATGGAGAACGTCTCTGATCCCTCGCATATAGAATTTGCTCACCACAAGGTCACTGGACG
AAGAGATAGAGCCAAGCCTTTGCCATTTAAAATGGAATCAAGTGGCGCATGGGGATATTCAGGGGCAAATACCGGCAATCCTCGCATCACTGCAACTTTC
GAGGCCCCTTGCTATGCACTGAACAAAATAGAGATTGACACCAAATTACCGATTGTGGGAGATCAGAAATGGGTCATATGGATTTGCTCCTTCAACATTC
CAATGGCCCCAGGGAAAACTCGTTCTATTGTCTGTAGTGCTCGAAACTTTTTCCAGTTTACAATGCCAGGAAAGGCATGGTGGCAGTTTGTCCCTCGATG
GTACGAACATTGGACCTCAAATTTGGTCTACGACGGCGATATGATCGTGCTTCAAGGCCAAGAGAAGGTTTTCCTGTCTGCATCCAAGGAGTCGTCTGCA
GATGTTAATCAGCAGTACACAAAGCTCACATTCACACCCACACAGGCCGACCGATTTGTTTTAGCATTCCGGGCATGGCTACGGAAATTCGGAAATAGCC
AGCCTGACTGGTATGGAAGTCCTAGCCAAGATGCATTGCCTTCTACGGTCCTTTCAAAGCGAGAGATGCTAGACAGATACGAGCAGCACACGCTGAAATG
CTCGTCCTGCAGAGGAGCGCACAAGGCCTTTCAGACTTTGCAGAAGGTGTTCATGGGGGCGACGGTGGTGTTTGGCGCGACATCCGGGATCCCTGCGGAT
GTTCAGCTCAGAATATTGCTCGGTGCCGGTGCTCTGGTCAGCGCCGCTCTGGCCTATGTCTTCTACGACCGCCAGAAGCATTTCGTGTTTGTGGACTACG
TGCACGCTGACATTGATTGATTAGGGAGATAAACATTAGTTATTTTTGTGAGGATCTGGTGTGGTGTGGTGTGGAGACATCCCACGATCAATCATGTGCA
TAACCTAGCCAAGGAGTACATATAGCTTTCAGTGGGTACATGAGATTGGCCCAGTATGTTGTTTATAACTTTATACTAGGCGCTGTATGAGCACTTACCA
GGCTA
page-top