Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20349  (registered. 2003)
Contig Information
Length 899 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit protein LRP16 [Zea mays]
Score 776
Evalue 1.26712e-80
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20349
TTTTTTTTTTGCTGTCACTTGCCGGCCATCTTATAGATATGAAAATGAAGCATAAAGAACGGTAAAATATTATTCAGGGCACTCATCCGGCATATCCATC
TAACTATCTTTCAGATAAACACATTCAAACTGCGCCATACATACGATCATGGTCAACAGACTCTAGTGGTCATATTAGACGCTGGCTAACATGCGCATAC
TACACTGATATCATAGTTATTTATTTCTCAAATTGCGTCAGCATCTCCTGGGCAGTCTCACGCCAAACGTTGTAGAGCTCATCCGAGAACAGAACAAAAT
GCACCTCTTTAATATCCCCTGAAATTTGTTGAGCAGCTGAAATAGCTATGTTTGATGCTTCCTTTGGAGGGTAACGGAAAATACCACAAGATATAGCAGG
GAATGCAACGTACTGAATGCCATTCTCTTTAGCAACCTTTAAGCTATTTTCGTATGCATTCTTTAGTGATACCTCAGGCTTCCTGTCCATATCATATATG
GGCCCAACTGTATGGATCACACGGGACACAGGAAGCTCAAAAGCTGGAGTAATTCTAGCTTCTCCAGTAGAGCAACGGACTCCAGGTTTAACCTCTGGAA
CTTCACGGCATGCTAGAACAAGCTGTGGTCCAGCAGCTTGATGTATAGCTCCATCAACACCTCCCCCTCCTAGCATTCGTTCATTAGCAGCACTGACGAT
GGTGTCGGTGGCGCCGTCGACGGACCAGAGGGTGATGTCGCCCTTGTGCAGCTTCAGCGCGCCGGCCCCCCGACGCAGCCGACAGCCGGAACGCCTCGCC
GCCTCCGAATCCAGACGCCGCCATCGCGAAGGCTCTCCTCGCTGGGCCGATGCTTGGCCGCCGCCTACGCAGCCACTTGGGAAGTGGAAGTGGGAGCAA
page-top