Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20281  (registered. 2003)
Contig Information
Length 990 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 4
Homology (BLAST) Top Hit seven-transmembrane-domain protein 1 [Zea mays]
Score 991
Evalue 1.73937e-105
Total Hit Count 308
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20281
CGATTTGCACTAGGGCAGACGAGAATGTTTCACGAAACTAAAGGACAGGCACACTCAAACTATCTAACAGATACCGGCACCATCATCCGGAATTAACTAA
CTCAAAATATCTTGTGCTAAATTAACTACTACTCAGAATATCACGGGCTAAAAATCTCTGCCGCCAGCTTGATTGGATCACTTGGCGACGGCGGGCCTAC
TGCTGCAAGCCAAGCTTATTTCTCAACGGTGACGGAGACCCTGCCGCCGCCAACGCTGTTCTTTGTGACTTTGACGGTAGGCAGCTCGACATTCTTCCCC
TTCTTGGGAGTCGACCTGTAGTAGCAGCCGTAGAGGATCAGCTGGGCGAGGCCAAAGACGGCACCGAGTCCATTGGGGATCGTGATGTAGAGGTCGAACT
TGATGAGCGCATAGGCCGTCCAGCAGCAGCCGTTGAGGAAGTTCACCAGGGAGAGGACGAATGGCATGTACTCCACGCTCCTGGTCTTGATCACTTTACC
CATGATGGTGAGCGGGGAGGCGTACATGACCGAGCCGAAGATGACGCAGAGGATGCCGACGATCATGGAGCGCTTCTCGTGGGTGTGGGCGCCGAGGAGC
ACGCCGGCCACCACGGCCACCATGAACAAGGCCTCGACGGCGAGCACGCCGAGCATCTTCAACCGTGTGTTCCTGGTGGCGTAGATGAAGAATATGATGA
GGTAGGCGCTCTCGATGACGAGCCCGATCCCGTTGATGGTGACGACGAGGATGCTGTTGGGGTGGACGATGGGGAGGCCGTAGAAGACCCAGAGCATGCA
GTTGAGCAGCGTCGCCAGGTAGGGGTCCGGCTTGAACTCCTCCACGTCCTTGGCCTTGATGATCCGCCAGAACGTCGGCACAGGGGAGAGGAAGAGCCCG
AAGGAGATGACATTGCCGACGATGCCGACGATGTTGCGGGCGGCGTCGGCGGAAACCATCTTGCTATCTTGATCGCCGGGAACACAGCTC
page-top