Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7370  (registered. 2012)
Contig Information
Length 777 bp
Clones alternative view 181 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 21
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 32
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 53
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 28
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 23
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig7370
CGCTCTTCCGAACCACCACAAAATATGTATTTCTTTTTTTTTTTATTCTTGTAAAAGTAGATCTTTATTGTAAAGGTTCACATGAAGTACAAAGCACCCC
AAACATAATAAACATTACATGAAGGTAGCTGGCCCACGAACGACCACTGTCCACACCGGAGCCGGCCCGATCTTGTCGATGACAACTGAGAAGTCTTTAT
GCACACGCCCCTAATGACATGTGCCCGCTCTGAAGCCGCAGTCATCGCCGTTGAAGCCCATGAACCCGACACCAAATCTCGCCGTCGCACACGCACGACA
AGAATACCCTAACCTCACCGCCCCGAGGAGCTGGCAGGAATCTACGCCGGACAACCACGAAGTTGAGGAGCCCGGGAGACCGTAACCGCAACCACAAGGA
CCACACATACACGGTGGTTCATAACAGAAATAGAAAGTGGAAGTACGTAGTATTTATTGTAATACGTAGTATTCTCTTTGCTGCTGCTATACGGTAGGCT
CAGTGAGCATGACTTGCAGCAAAGTGTGGCGCATGGCCATGGGCATCATGCCCCATGTTTCCTCCCGCACACGTGCCTTTCTTGAAGTAGAGGCATGGAG
CACCTGCCTTGGCCTTGCCATCGGCCGCCGATTGCTGAGGAGATTGCTCGTCCACGGCCTGCTTGTTGAGGTCGGTGCTCCGGCGGTCATCACCGGCCGG
CGCCTGGAAATCCATCGCCTATTAGCTCTGCTCAGCTCAGCTCCTCCTCCACCTCCTCGAGCTCTCCAAGCCCCCGG
page-top