Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20234  (registered. 2003)
Contig Information
Length 1308 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit histone acetyltransferase HAT2 [Triticum aestivum]
Score 2151
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20234
CCGGGCAAGGTACAATCCATATGTGCAAGCCAGAAGCAGGATAGATCAGCTCAAAAGGCTCGGACATAGTGCGGATAAGGTCGAGTTCATTTTGATGGGT
GGGACTTTCATGTCGTTACCGGCTGATTATCGTGATTATTTCATCAGAAATCTCCATGATGCTTTATCGGGACATACTTCTGCTAATGTTGAGGAGGCGG
TTTGTTATTCAGAACATAGTGCTGTCAAATGTATCGGTATGACAATTGAGACGAGACCTGATTATTGCCTGGGGCCTCATCTGCGGCAAATGCTATCTTA
TGGATGTACCCGCTTAGAAATTGGTGTGCAGAGTACATATGAGGATGTTGCACGTGACACAAACAGAGGCCATACAGTAGCTGCTGTTGCTGATTGTTTT
TCTTTAGCAAAAGATGCTGGTTTTAAGGTGGTTGCGCACATGATGCCAGATTTACCTAATGTTGGAGTTGAGAGGGATATGGAAAGTTTCAGAGAATTTT
TTGAAAATCCAGCATTCCGAGCAGATGGTCTAAAGATCTATCCAACTCTTGTGATTCGTGGAACTGGTCTTTATGAGCTATGGAAAACTGGAAGGTATAG
AAACTACCCACCAGAGCTGCTAGTGGATATTGTAGCAAGGATTCTGTCGATGGTACCACCATGGACACGAGTCTATCGGGTCCAGAGAGATATCCCTATG
CCTCTTGTTACTTCTGGTGTTGAGAAAGGTAACCTGCGTGAGCTTGCTTTGGCTCGAATGGAAGACCTGGGCTTGAAATGCAGAGATGTCAGAACCCGTG
AGGCTGGAATTCAGGATATCCATCACAAGATCAGGCCTGATGAAGTTGAGCTTGTCAGGCGTGATTACGCTGCAAATGACGGTTGGGAGACCTTTCTCTC
GTATGAGGATACACGACAGGATATCCTTATTGGCCTGTTGCGCTTGCGTAAATGTGGCCGCAATGTTACAGGCCCTGAACTCGTAGGGAGGTGTTCAATT
GTCCGTGAACTTCATGTCTACGGAACAGCGGTCCCTGTGCATGGTCGTGATGCAGAGAAACTGCAACACCAGGGGTATGGGACGCTCCTGATGGAAGAAG
CAGAGAGAATTGCTCGTAAGGAGCATCGATCAAAGAAACTGGCCGTCATCTCAGGAGTTGGAACCCGCCACTACTACCGCAAGCTGGGCTATGAACTTGA
GGGGCCTTACATGGTCAAATGTCTGGCATAGTGTATTTCAGCATCAAATGGCAATTGTATTGCAACTAGAAAAATCAAATGTGATCATGATGTTAAGTGT
AATGTATT
page-top