Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20200  (registered. 2003)
Contig Information
Length 932 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_06722 [Oryza sativa Indica Group]
Score 1295
Evalue 8.89935e-141
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20200
CCCCTCTCCGATCCACCGACCCCTAAGGTCCTCGCGGCCGAGTCAGCCATGGCGGGGGCGATCCGCGTCACCATGGAGGTGGGCGCAGACGGCGTCGCGC
TCATCACCATCTGCAACCCGCCAGTCAATGCTCTGCACCCCATCATCATCCAGGGGCTCAAGGAGAAGTACGCGGAGGCCGCTGATCGCGACGACGTCAA
GGCCATCGTGCTCACTGGTGCTGCGGGGAAATTTTGTGGAGGCTTCGATATCAACGTCTTCACAAAAGTTCATGAGACTGGAGATGTGTCACTTATGCCT
GATGTATCTGTTGATCTTGTATCAAACATGATGGAAGATGACAAAAAGCCTTCTGTTGCTGCAATTCAAGGCCTTGCTCTTGGTGGTGGTCTAGAGTTGA
TTATGGGTTGTCATGCTCGGATATCTACCCCTGAAGCTCAACTTGGATTACCAGAGCTAACTCTTGGCGTGATTCCTGGATTTGGAGGAACTCAGCGTCT
ACCGAGGCTTGTAGGTCTGCCCAAAGCAATAGAAATGATGCTGCAATCGAAGTTCATTACGGCGAAGGAAGGAAAAGAACGTGGTCTTATTGACGCGCTT
TGCTCCCCTGATGACTTGATAAAAATTTCACGTTTTTGGGCTCTGGAGATTGCAAATTACCGCAAACCTTGGATAAAATCTCTTGGCAGAACAGATAGGC
TTGGTTCACTGTCTGAAGCTCGTGCCGTATTAAGTATGGCAAGACAACAAGCAAAGAAGGTTGCAGCAAACATGCCACAGCACCAGGCCTGCCTAGATGT
TGTTGAAGAAGGTGTACTATATGGAGGCCAGGCTGGTGTTTTGAAGGAAGCCAAGGTTTTCAAGGAGTTGGTACTATCAACAACGTCAAGGGCACTTGTC
CATGTATTTTTTGCCCAGCGTTCCACCACTAA
page-top