Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20179  (registered. 2003)
Contig Information
Length 517 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit possible membrane protein LEM1 [Hordeum vulgare]
Score 265
Evalue 6.75263e-22
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20179
CGGCGGTCGCCGCAGCGTCCGGGCCCAGCCGGCGGGGCTGACGCAGTGCATGGGCGGGTGCGGGACGAAGGTCGCATCGTGCCTCCTCGACTGCTACAAC
ACGTCCACCGGAGGGACCATGCCCATCTGCTACCTCGGATGCACCAACAACGCCGTCTTCTGCGCCACCGACTGCACCACCCAGGGGCTCTGATCCCCAA
TCAATCCATCGATCAACCCATCCGGCCAGCGATGAACAATATATAGCCTCAATCTGTATGACATCATATATATGTATCAACGCATACGCACCGCATGCAT
ATATAATGCATTCACGCGCAATCAAGCATACTGCATAGACATTCCACCCCGGCCCGGCCCCTCTCAGGTATGAATGAATAATATCAGTTGTACTACTACG
TTTCACTCGACCCGTTCCACTAGACGCACGCGAGCTTGTATGCTCAAGTGATGACTAGTGAATATACACAGCTTGCTATTATGTGCTTTACATAATGATT
CTATCCCAAAAAAAAAA
page-top