Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20134  (registered. 2003)
Contig Information
Length 865 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit GD25283 [Drosophila simulans] >gi|194194325|gb|EDX07901.1| GD25283 [Drosophila simulans]
Score 87
Evalue 0.926769
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20134
TAACTGGATCATAAACCCACAAATTCATCAGTCTCAATAAACACACCGCAAAAAGAAGATTACATCGAATAGATCTCCACGAGAGGGGGAGAACATTGTA
TTGAGATCCAAAAAGAGAGAATAAGCCATCTAGCTACTAGCTATGGACCCGAAGGTCTGAAGTAAACTACTCACACTTCATCGGAGGGGCTATGGTGTTG
ATGTAGAAGCCCTCCGTGGTGGATGCCCCCTCCGGCAGAGCTCCGGAACATGCCCCAAGATGGGATCTCGTGGATACAGAAGGTTGCGGCAGTGGAATTA
GGTTTTTGGCTCCTCCTTGATCGTTTGGGGATACGTAGGTATATATAGGAGGAAGGAGTACGTCGGTGGAGCAACAGAGGGACCACGAGGTAGGGGGCGC
GCCCTCCACCCTCGTGACCGCCTCTGGCACTTCTTGGAGTAGGGTCCAAGTCTCCTGGATCACGTTCGGTGAGAAAATCACGTTCCCGAAGGTTTCATTC
CATTTGGACTCCGTTTGATAGTCTGTTTGTTCGAAACACTGAAATAGGCAAAAAACAGTAATTCTGGGCTGGGCCTCCTGTTAATAGGTTAGTCCCAAAA
ATAATATAAAAGTGGAAAATAAAGCCCAATATAGTCCAAAACAGTAGATAAAGTAGCATGGAGCAATAAAAAATTATAGATACATTGGAGACGTATCACT
TAGTCGCTGACGTCTATTAAGCTTCGGCTGATGTATACTGTCGGTGTCAAAACCGGCGGATCTCGGGTAGGGGGTCCCGAACTGTGCGTCTAGGCGGATG
GTAACAGGAGACAAGGGACTTGGATGACCTAAGGTTTATCAATCTGTAGGAGGCGCAGGTAAACT
page-top